1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
2 years ago
5

*URGENT* Why do we think of ecosystems as systems within systems?

Biology
1 answer:
Alexandra [31]2 years ago
7 0

Answer:

In systems, the relationships between individual parts may be more important than the parts. An ecosystem is not just a collection of species, but includes living things interacting with each other and their nonliving environment. In the systems view, the "objects" of study are networks of relationships.

Explanation:

Hope it's help

You might be interested in
What are two main abiotic factors that affect organisms in marine ecosystems? A. Oxygen level and water temperature B. Predators
Lesechka [4]

Answer:

dear user the answer is option A.oxygen level and water temperature and C.salinity and water temperature.

hope this helps

if it's useful to u plz thank and try to mark as brainliest

5 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Which two biomes are the most similar with regard to rainfall?
prisoha [69]
Salutations!

The two biomes that are the most similar with regard to rainfall is desert and tundra. Tundra is the coldest biome, its tree less with very little nutrients, precipitation and seasons often remain the same. Desert is very hot in the day, but very cold at night, it receives less rainfall and has very strong winds.

Hope I helped (:

have a great day!
3 0
3 years ago
HURRY PLS!! The structure of DNA resembles a twisted ladder. Which structural components from the rungs of the ladder
Zina [86]

Answer is: C

Hopefully this helps you, have a nice day! :)

in addition to that; (it's pairs of 4 types of (c))

6 0
3 years ago
write a 5-7 sentence paragraph explaining what happens to co2 levels in the world over the course of the year. add as much conte
Hunter-Best [27]

Answer:

The amount of CO2 found in the atmosphere varies over the course of a year. Much of this variation happens because of the role of plants in the carbon cycle. Respiration happens all the time, but dominates during the colder months of the year, resulting in higher CO2 levels in the atmosphere during those months.

Explanation:

4 0
2 years ago
Other questions:
  • a map has a scale of 1 cm 12 km. on this map,what is the distance between two locations that are actually 30 km apart?
    8·1 answer
  • Identify and explain three major issues that cut across psychology
    11·1 answer
  • If dimples (D) are a dominant trait, which of the following crosses could result in a child without dimples?
    9·2 answers
  • What are some examples of microorganisms
    9·1 answer
  • Explain how sick cell anemia occurs and how amniocentesis is used by pediatricians. PLEASE ANSWER AS SOON AS POSSIBLE!!!
    8·1 answer
  • The fossil evidence found in these sedimentary layers BEST implies that A) invertebrates evolved into vertebrates. B) animals ev
    14·2 answers
  • Give an example of a biochemical similarity between two different organisms
    7·2 answers
  • A scienntist is examining an organism that feeds on decaying matter to gain energy for survival. What kingdon would be the best
    9·1 answer
  • Which of the choices below gives the best "big picture" snapshot of what is happening in the body?
    13·1 answer
  • Which genetic mutations cause damage to an individual organism?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!