The answer is climate and weather.
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
If the earth did not rotate on its axis then the atmosphere would only circulate on its poles and the equator in a simple back and forth pattern.
The structural components of the mammalian nephron where the transcytosis of water increases due to the action of anti-diuretic hormone is/are the collecting duct. ADH is a hormone made by the hypothalamus in the brain and stored in the posterior pituitary gland. It acts on renal collecting ducts via V2 receptors to increase water permeability, which leads to decreased urine formation. This increases blood volume, cardiac output and arterial pressure.
