1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crank
3 years ago
9

By how much did carbon dioxide levels increase from 1980 too 2000

Biology
1 answer:
Scrat [10]3 years ago
3 0
20? I think lol sorry if I am not much of a help




You might be interested in
Which obsevation could lead to the conclusion that an object is nonliving <br>​
anastassius [24]
If the object doesn’t contain carbon. All living things contain carbon in some way. Except monoxide, dioxide, carbides, and carbonates
6 0
3 years ago
The function of beta-galactosidase is to ______.
kiruha [24]
The answer to the question is the letter "A" Breakdown glucose.

The function of beta-galactosidase is to break down glucose. This beta-galactosidase is also commonly called "Beta-gal". This enzyme breaks down the glycosidic bond, it also includes carbohydrates that contain glucose.
5 0
3 years ago
Humans carry a variety of non-functional genetic sequences, called processed pseudogenes, in their DNA. We can estimate how long
IrinaVladis [17]

Answer:

The correct answer is - c. CALM II psi3 (36 million years old)

Explanation:

7 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Water which is returned to the environment after secondary treatment is known as:
Mashcka [7]
The answer to this question is evaporation
8 0
3 years ago
Other questions:
  • True or false<br>many trials are not needed before a hypothesis can be accepted as true
    10·2 answers
  • Please help me on this thank you
    7·1 answer
  • Read the statement and then apply it to the scenario. Statement In science, it is not possible to prove hypotheses right. This i
    15·2 answers
  • A gland is a group of cells or an organ that
    8·1 answer
  • Which of the following are not characteristics of the cell wall
    9·1 answer
  • A commercial advertising a diet pill says it is scientifically proven to help you lose weight. It is recommended by a doctor who
    9·2 answers
  • What is warmer -6°F or -10°F
    8·2 answers
  • How many daughter cells are created at the end of meiosis 1?
    6·1 answer
  • please help me please help me please help me please help me please help me please help me please help me please help me please h
    15·1 answer
  • Question 1 (3 points)
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!