1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cerrena [4.2K]
2 years ago
14

Word bank:

Biology
2 answers:
KengaRu [80]2 years ago
6 0

Answer:

your correct answer is

1. Circulatory System

2. White Blood Cells

3. Capillaries

4. Vein

5. Carbon Dioxide (CO²)

6. Circulatory System

7. Immune System , Fights

8. Red Blood Cells

9. Gas Exchange

10. Transport

11. Lungs

12. Artery, Heart and Lungs

13. Heart

14. Important Plant

15. Alveoli

Simora [160]2 years ago
4 0

Answer:

1. Circulatory System

2. White Blood Cells

3. Capillaries

4. Vein

5. Carbon Dioxide (CO²)

6. Circulatory System

7. Immune System , Fights

8. Red Blood Cells

9. Gas Exchange

10. Transport

11. Lungs

12. Artery, Heart and Lungs

13. Heart

14. Important Plant

15. Alveoli

You might be interested in
Which of the following function is NOT a function of ground tissue in a plant?
solong [7]
The answer is b)produces sugars
8 0
3 years ago
Read 2 more answers
A team of students is performing an experiment to determine how the speed of a reaction between HCl and Na2CO3 changes with temp
Naddik [55]
A team of students is performing an experiment to determine how the speed of a reaction between HCl and Na2CO3 changes with temperature. The aspect of the  experiment that does not have to be kept constant would be the initial concentrations of the reactants. Hope this helps. Have a nice day.
6 0
3 years ago
Predict how changing the grass population will affect the other organisms at first. Write + for “Increase” or – “Decrease” next
Afina-wow [57]

Answer: Here you go!

Explanation:

Doubling the amount of grass would definitely increase the rabbit population since there is more food/resources for it to produce. Since the food chain has a domino effect everything else would go up as well because of the increase of food/resources that will help sustain the population of all. so for the first line it would be increase for rabbit snake and hawk. Halving the amount of grass would effect the population of all animals as well. But in a more negative way. It would decrease because the rabbits wouldn't have enough food to produce and thrive. With the decline of rabbits less snakes will live because of the low amount of their main food source. Same with the eagles. So therefore it would be decrease in all the bottom lines.

5 0
2 years ago
How much oxygen is available at a peak of a mountain
sergij07 [2.7K]
Depends on what mountain you are on 


If you are on Everest, then the amount of effective oxygen available would be 6.9% (0 altitude would be 20.9) 

that is why anyone should always bring oxygen tanks when climbing a high mountain
3 0
3 years ago
What is one biotic factor that affects the size of a population in an ecosystem?
Jobisdone [24]
Remember that a biotic factor is a living component in an ecosystem that affects the population of another organism. So that means that the answer is B.
7 0
2 years ago
Read 2 more answers
Other questions:
  • Insects are the largest single group of animals on earth true or false
    7·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Meiosis results in a reassortment of maternal chromosomes (inherited from the mother) and paternal chromosomes (inherited from t
    5·1 answer
  • Blood has traveled from the heart to the toes. Which describes the next step
    5·1 answer
  • You are studying two linked genes that influence vine height and fruit color in squash. Yellow color is dominant over green, and
    9·1 answer
  • Which of the following mammals were domesticated about 2000 years ago and are currently herded by native people of northern Asia
    12·2 answers
  • 7. Explain why there is a difference in the amount of oxygen taken in at rest and during the vigorous activity, (2​
    9·2 answers
  • Identify the small facial bones found in the medial wall of the orbit.
    12·1 answer
  • Advantages of lipase enzyme on the environment
    8·1 answer
  • All of the following are negative examples of how climate change has impacted the Earth EXCEPT...
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!