1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KATRIN_1 [288]
2 years ago
12

What’s the answer?????? #10

Mathematics
1 answer:
Marizza181 [45]2 years ago
5 0

Answer:

1024 or A

Step-by-step explanation:

64 x4 is 256 x4 it's a 1024

You might be interested in
the temperature was 15 .it dropped so that the temperature was 0 . what integer represents the change in temperature?
Nataliya [291]

Answer:

if the temperature was at 15 and dropped to zero the amount it changed would be is -15. The integer is -15 because an integer is a whole number and it can also be a negative or positive number it just can not be a fraction

3 0
3 years ago
find the probability of being delt 5 clubs and 3 cards with one of each remaining suit in 8 card poker
kumpel [21]

Answer: 0.003757(approx).

Step-by-step explanation:

Total number of combinations of selecting r things out of n things is given by:-

^nC_r=\dfrac{n!}{r!(n-r)!}

Total cards in a deck = 52

Total number of ways of choosing 8 cards out of 52 = ^{52}C_8

Total number of ways to choose 5 clubs and 3 cards with one of each remaining suit = ^{13}C_5\times^{13}C_1\times^{13}C_1\times^{13}C_1  [since 1 suit has 13 cards]

The required probability = =\dfrac{^{13}C_5\times^{13}C_1\times^{13}C_1\times^{13}C_1}{^{52}C_8}

=\dfrac{\dfrac{13!}{5!8!}\times13\times13\times13}{\dfrac{52!}{8!44!}}\\\\=\dfrac{24167}{6431950}\\\\\approx0.003757

Hence, the required probability is 0.003757 (approx).

5 0
3 years ago
Can someone kindly explain and answer this for me please!
Lubov Fominskaja [6]

Answer:

25

Step-by-step explanation:

7 * 7 = 49

24 * 24 = 576

576 + 49 = 625

\sqrt{625} = 25

Please mark as brainliest

5 0
3 years ago
Read 2 more answers
Help pls don't answer if you don't know also I’ll give brainliest
il63 [147K]

Evaluate for x=4,y=4,z=4

|(2)(4)−4+(3)(4)|

|(2)(4)−4+(3)(4)|

=16

Answer=16

(PLEASE GIVE BRAINLIEST)

8 0
3 years ago
A survey finds that 40% of students ride in a car to school. Eri would like to estimate the probability that if 3 students were
Butoxors [25]
The answer is 0.60 I know cause I took the test
3 0
3 years ago
Read 2 more answers
Other questions:
  • On Wednesday, the temperature in Vancouver, Canada, dropped from 29 degrees F to -17 degrees
    15·1 answer
  • What is 9 2/3 -2 6/7
    8·1 answer
  • Help me please :)
    10·1 answer
  • Alberto is in charge of making lunch at summer camp. He knows that 3 tuna casseroles will serve 15 campers. How many tuna casser
    10·1 answer
  • How do u add and subtract negative fractions?
    8·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • This is probley easy...
    12·2 answers
  • the average weight for a newborn baby is 7.5 lb. The average weight for a 1 year old is 19 pounds 10 ounces. How many ounces do
    8·1 answer
  • 13 is 65% of what number?​
    13·1 answer
  • How do I do C?Someone please help asap.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!