1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivahew [28]
2 years ago
6

An effective short-term remediation strategy for the pond would be to.

Biology
1 answer:
Ivahew [28]2 years ago
7 0

From what we know, we can confirm that one effective short-term remediation strategy for the pond would be to use tertiary water cleaning treatment protocols.

<h3>Why is this a temporary solution?</h3>

This has to do with the fact that for a body of water such as a pond, these protocols will work just fine in order to clean the water, however, it does not tackle the root cause of the contamination and therefore the solution will only be temporary.

Therefore, we can confirm that one effective short-term remediation strategy for the pond would be to use tertiary water cleaning treatment protocols.

To learn more about water treatment visit:

brainly.com/question/1414153?referrer=searchResults

You might be interested in
Which bacteria require oxygen to live and grow?
Basile [38]

Answer:

Aerobic

Explanation:

7 0
3 years ago
Read 2 more answers
Help me plz <br>its for 9th grade biology or 10th grade​
shepuryov [24]

Answer:

The answer should be X^{A} Y^{A}

Since the pedigree has two different letters, it will have one letter of each, but the DNA will still be A.

3 0
3 years ago
Some neurons have a fatty layer covering called around their axons. This layer isn’t continuous, and the gaps are called . The a
sp2606 [1]
Some neurons have a fatty layer covering called MYELIN SHEATH around their axon. This layer is not continuous and the gaps are called NODES OF RANVIER. 
Because the myelin sheath is made up of insulating fatty substances, the nodes of ranvier allow the fast transmission of electrical impulses along the axon.
6 0
3 years ago
Cells _________ in order to create cells that perform specific functions.
nika2105 [10]

Cells differentiate in order to create cells that perform specific functions.

8 0
3 years ago
Read 2 more answers
Which statement applies only to electric force instead of both electric and
german

Answer:

d it Acts between charged particles

3 0
3 years ago
Other questions:
  • True or False? At divergent boundaries, there are long fault lines leading to more earthquakes developing over time. At a transf
    8·2 answers
  • A type of muscular dystrophy, called severe childhood autosomal recessive muscular dystrophy (SCARMD), results from a mutation i
    13·2 answers
  • When sodium ions enter the cell, water exits to maintain fluid balance?
    12·2 answers
  • Suppose that 75% of chickadees (a bird) have a head crest and must therefore have at least one copy of the dominant H allele. As
    6·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • A millimeter is _______ Meters
    9·2 answers
  • Which is the highest level of organization within an organism?
    7·1 answer
  • PLEASE HELP ME ANSWER THIS QUESTION....QUICKLY BFORE BUNNY EAT YO PIZZA .
    10·2 answers
  • Which is an example of mutualism?
    11·2 answers
  • How are dna base pairs found and how are they paired with each other?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!