Answer:
to know what you're talking about
b because im trying to help hope it helps :)))
Answer:
The correct answer is B. <em>Philippine plate converging with the Pacific plate, forming Mariana Islands in the Pacific Ocean</em>
Explanation:
When two oceanic plates collide, it occurs oceanic convergence. The thicker and older plate subduces under the other plate, and at this point, it starts the volcanic activity. As the thicker plate descends, it is heated and melted and its materials are incorporated into the mantle. The fast subduction originates magma that ascends to the surface by crevices. This makes place to the formation of grouped volcanic islands, the island arches. Subduction zones coincide with deep-sea trenches or depressions in the ocean bed. The volcanic islands are arranged in a circumference arch shape, which is bordered by a fossa. Most of these are located in the western Pacific, where the pacific crust is older and thicker, and hence it submerges easier in the mantle.
The Mariana Islands in the Pacific Ocean are examples of these volcanic islands.
Answer:
Hello There!!
Explanation:
I believe the answer is A. To meet needs through collective effort.
hope this helps,have a great day!!
~Pinky~
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: