1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BigorU [14]
3 years ago
13

Cerebrum has its upper surface gray but the upper surface of the spinal cord is white. give reason​

Biology
1 answer:
goblinko [34]3 years ago
7 0

The answer is white matter in the spinal cord is called superficial tissue because it is located in the outer region of the brain and spinal cord.Myelin a protective coating for neural axons is made of lipid tissue that appears white on a freshly dissected brain.

You might be interested in
Need help with this please!!!!
kotegsom [21]
Hope this helps!!!
1. Parasite
2.commensalism/parasite
3.commensalism
4. Parasite
5.commensalism
6.commensalism
7. Mutualism
6 0
2 years ago
Sublimation happens when heat increases in a solid, and the
vladimir1956 [14]

Answer: This phase change is called sublimation. Each substance has a characteristic heat of sublimation associated with this process. ... Solid carbon dioxide is called dry ice because it does not pass through the liquid phase. Instead, it does directly to the gas phase.

I hope this helps

            ~Princess <3

8 0
3 years ago
Compare surface, subsurface, and placer mining in terms of damage to the environment.
vfiekz [6]
Surface mining, which is also known as strip mining, is when soil and rock overlaying mineral deposit is removed. It can cause habitat destruction, air pollution from dust particles, soil erosion and pollution. Subsurface mining is removing deposits from the Earth by drilling underneath layers of rock and dirt. To keep the pathways clear, <span>mining companies have to pump out large amounts of water, which go into surface ecosystems. That disrupts the ecosystem by changing the pH conditions of soil and water sources. Placer mining is mining of stream bed deposits for minerals, a way of obtaining minerals and metal resources. Although, because it is small, causes less damage to the surrounding environment it still can disrupt river ecosystems with pollution and sediments. 
 

I hope this helps!!

</span>
5 0
2 years ago
Read 2 more answers
If you were given a 3D microscope to use for photography, which object(s) would you most want to photograph? Why?
Troyanec [42]

Answer:

Explanation:

I would like to photograph a tulip, because I have always been interested to know more about some flowers and what’s in the inside of them. Even though tulips look pretty “simple” but beautiful in the outside, I suspect that there are a thousand of different things inside of it.

8 0
3 years ago
DONT ANSWER ALL THE PAGES JUST ANSWER THE LAST 2 PLAGES<br> giving brainliuest
Nataliya [291]

Answer:

31. Seatbelts lock in place to make sure you don't go flying into the windshield.

32. Friction causes the soccer ball to slow down. If we were to kick a soccer ball in space, where there is no friction, it would keep on rolling until it eventually hits something or goes out of sight.

33. Heavier loads will make the vehicle move off of the table. The heavier the weight, the quicker the  vehicle will roll. Loads that are something very similar or lighter than the vehicle won't make the vehicle move by any means.

34. Gravity is the power pulling the piano toward the Earth.

Friction would happen with an unpleasant surface, making it a lot harder to push the piano up the ramp.

35. Wagon C

Wagon C has the least boxes and minimal measure of mass, making it simplest to move.

36. I would move the crates so every cart has a similar measure of boxes, making them equivalent in mass. This would make them all take a similar measure of power to move them.

Explanation: I have the answer key

7 0
3 years ago
Other questions:
  • Summarize dnas importance to you​
    10·1 answer
  • What is the importance of having bacteria that is helpful
    8·1 answer
  • Two species of clams inhabit the same marine habitat along the Atlantic coast. One releases gametes into the water in early spri
    10·1 answer
  • The burning of fossil fuels contributes to<br>​
    11·2 answers
  • What is the effect of medicines given to people suffering from viral diseases?
    5·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Develop a scenario with a Punnett Square and discuss how the offspring outcomes change if the gene
    6·1 answer
  • Which of the following plant propagation methods requires sterile conditions?
    14·1 answer
  • Imagine you were an animal that lived in the tundra. What are three adaptations that would help you survive by either finding fo
    6·2 answers
  • Name the TWO planets in our solar system where there are life forms<br>​
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!