Cohesion occurs when molecules of the same substance are attracted to each other.
Hope this helps!
Energy moves from one trophic level to another as organisms feed on one another.
Explanation:
Energy flows from one trophic level to another in a food chain. according to the ten percent law, only ten percent of the total energy passes onto the next trophic level. While studying the energy flow model two aspects should be taken under consideration. Firstly, the flow of energy is unidirectional and passes on from autotrophs to primary consumer and then secontary, tertiary so on. Secondly the amount of energy decreases at succesive trophic level.
Answer:
The movement and interaction of tectonic plates helps to explain many of Earth's features. Interpret data showing topography, the age of the sea floor, the location of volcanoes, and the location of earthquakes to predict the location and type of plate boundaries in a region.
Explanation:
Answer: Hydrogen bonding of water molecules
Explanation: These attractions are an example of hydrogen bonds, weak interactions that form between a hydrogen with a partial positive charge and a more electronegative atom, such as oxygen.
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
