1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nimfa-mama [501]
2 years ago
11

Hemophilia is a disease that causes uncontrollable bleeding. If a father has it, all of his daughters will be carriers of the di

sease, and about half of his sons will have the disease.
Which macromolecule is involved in how hemophilia is passed from parents to their children?
Biology
1 answer:
Svetllana [295]2 years ago
3 0

Explanation:

Hemophilia is a disease that is characterized by an abnormal blood clotting process. There are many different proteins that are involved in the clotting process and a single mutation or change in one of them could result in serious effects. Hemophilia is characterized by an abnormal version of one of the many proteins involved in the clotting process, the proteins that are commonly affected are the coagulation factor 8 or 9 (VIII or IX). These abnormal proteins are caused by a mutation in the gene (within the DNA) that codifies for the production of each protein. In other words, a mutation in the part of the DNA, (gene F8) will lead to a dysfunctional coagulation factor VIII and a mutation in the gene F9 will lead to a dysfunctional coagulation factor IX. Importantly, these mutations could be inherited and could cause hemophilia. Therefore, an error in the DNA and subsequently, an error in the protein will cause hemophilia. Finally, it is important to mention that there are other types of hemophilia that are not caused by the above-mentioned mutations, such as acquired hemophilia.

You might be interested in
Which organelle recycles molecules for the cell to use again?
Sphinxa [80]

Answer:

lysosomes

Many components of the cell eventually wear out and need to be broken down and the parts recycled. This activity takes place inside the cell in specialized compartments called lysosomes.

3 0
3 years ago
How do protozoans affect the ecosystem
Dominik [7]
I guess it science Oklahoma And ecosystem and protozoans Andrew And thanks
5 0
3 years ago
Which type of society is most likely to produce a great number of crops?
andrew11 [14]

Answer:

B. Postindustrial

Explanation:

A type of society in which food production—carried out through the use of human and ... Production is slow, and the amount that can be produced is limited. In preindustrial societies most economic activities are carried out within the home setting. ... Higher crop yields allow agricultural societies to support large populations.

7 0
3 years ago
Which of the following processes returns carbon from this vast reservoir to the active carbon cycle? ( More than one answer may
aleksandr82 [10.1K]

A and D are the answers.

5 0
3 years ago
Read 2 more answers
When a biological vector is used, which process must take place before recombinant DNA can be placed in the host cells?
MAXImum [283]
Gene isolation i think not 100% tho
7 0
3 years ago
Read 2 more answers
Other questions:
  • How do enzymes affect the activation energy of a reaction
    6·1 answer
  • What is the ratio of C, H, and O in monosaccharides?
    11·1 answer
  • Name a practice in industry or in households that is adding pollution to the
    15·1 answer
  • How is industrial land use different from other land uses in terms of water?
    15·2 answers
  • When a cell is placed in a hypertonic solution which direction would the water move?
    13·1 answer
  • Who created artifacts such as iron
    7·1 answer
  • How does armillaria impact peoples lives?
    11·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • - is a covalent compound stimulates the pleasure areas in our brain making us feel good ,speed up the activity in brain and keep
    8·2 answers
  • After Elijah dropped a pass in an important football game, he became depressed and vowed to quit the team because of his athleti
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!