The answer is B. Friction causes a loss of energy. The
pressure located within the arteries and arterioles fall when blood moves away
from the heart because the friction that is being produced when blood is moving
away from the heart causes a loss of energy, which makes the pressure fall.
This is called a secondary consumer, and they are usually not plantalia.
All carbohydrates, including sugar, therefore contain the same three elements: carbon, hydrogen<span> and </span>oxygen<span>. Different arrangements of these elements </span>form<span> single units to make different types of carbohydrates. Glucose, for instance, is a single-unit carb with six </span>carbon atoms<span>, 12 </span>hydrogen<span> atoms and six </span>oxygen atoms<span>. hope this helps . </span>
Geophysicists are Earth scientists. Hope this helps!
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’