1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandr82 [10.1K]
3 years ago
13

Which type of mutation? A. Insertion B. Substitution C. Deletion D. Addition

Biology
1 answer:
Dmitriy789 [7]3 years ago
3 0

It is a substitution mutation because one strain got substituted with another strain and there wasn't an increase/decrease in strain and none of the strains got shifted over.

Hope that helped!

You might be interested in
For the water flea experiment the best answer is ______
WARRIOR [948]

c is the correct answer

8 0
3 years ago
What is the purpose of a cell wall
Pavel [41]

It gives support and structure to the plant cell

5 0
3 years ago
On the Fahrenheit Scale, between labeled temperatures, each smaller increment the stands for how many degrees?
damaskus [11]

Answer To This Question:

Explanation For This Question:

7 0
3 years ago
An individual's microbiota is in a constant state of ________.
IgorLugansk [536]

Answer is b. flux

Different types of micro-organisms either live in on the human body. Microorganisms live on the skin or in the gastrointestinal tract. Collectively these microorganisms are called microbiota. An individual's microbiota is in a constant state of flux (state of flowing)    


4 0
3 years ago
What is the benefit of plants having root hairs and what is thier function
Ganezh [65]

Explanation:

A root hair[1], or absorbent hair, the rhizoid of a vascular plant, is a tubular outgrowth of a trichoblast, a hair-forming cell on the epidermis of a plant root. As they are lateral extensions of a single cell and only rarely branched, they are visible to the naked eye and light microscope. They are found only in the region of maturation of the root. Just prior to, and during, root hair cell development, there is elevated phosphorylase activity.[2] Plants absorb water from the soil by osmosis. Root hair cells are adapted for this by having a large surface area to speed up osmosis. Another adaptation that they have is root hair cells have a large permanent vacuole.

5 0
4 years ago
Read 2 more answers
Other questions:
  • Compare physical feature of freshwater and marine cetaceans. Speculate how those physical differences might provide advantages t
    5·1 answer
  • In 1918, an epidemic of sleeping sickness caused an unusual rigid paralysis in some survivors, similar to symptoms of advanced P
    12·1 answer
  • 1
    15·2 answers
  • Using the graph, please identify the predator and prey. How can you tell which is which?
    8·1 answer
  • HELP PLEASE! WILL GIVE BRAINLY! Describe a strong, bond in which electrons are unevenly shared between two atoms due to a differ
    6·1 answer
  • Occasionally asexual reproduction can cause undesirable proliferation of an organism.
    5·2 answers
  • What are some freshwater systems and what do they all share in common?
    14·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • A major factor in changing the frequencies of the genes in the gene pool
    7·1 answer
  • Another question for today help me plz<br><br> And plz give me brainlyest
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!