1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fiasKO [112]
4 years ago
10

The acronym PMS stands for:

Health
2 answers:
mixer [17]4 years ago
6 0
Premenstrual syndrome
tatiyna4 years ago
6 0
Premenstrual syndrome which happens before a woman gets her period
You might be interested in
Mark wants to lose some weight fast, so he decides to take some diuretics. Select the statement that BEST represents the result
Pani-rosa [81]
The answer is D.  I'm a certified medical assistant and worked 14+ yrs. in the medical field.

5 0
4 years ago
Read 2 more answers
8) True or False<br>Managing your time is a way to gain stress<br>True<br>False​
butalik [34]

Answer:

I think the answer is false

7 0
3 years ago
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
Air enters the nasal cavity of the respiratory system through the
grandymaker [24]

Air enters the nasal cavity of the respiratory system through the nostril . The nasal cavityis divided by the midline nasal septum Thenasal cavity mucosa has several functions. Its major functions are to warm, moist and clean the incoming air.

The nasal cavity and the mouth meet at the pharynx, or throat, at the back of the nose and mouth. From there, air quickly enters the second part of your respiratory system, the trachea or windpipe. The trachea is a tube that delivers air to the lungs, the third and most important part of your respiratory system.

8 0
3 years ago
Being sexually active can impact teenagers emotionally. Discuss one emotional impact of sexual activity.
Savatey [412]
It can give a person an emotional impact with the person they are sexually active with. They could have strong feelings for that person and want have a meaningful relationship with them. But that person could not want the same things and it could lead to heartbreak and hurt feelings. 
6 0
3 years ago
Read 2 more answers
Other questions:
  • A patient is ordered Erythromycin suspension 1.2g. The drug is available in 400mg/5mL. What volume of the suspension do you requ
    5·1 answer
  • A patient can use a medicating cream as desired. What does this prescription most likely indicate?
    6·2 answers
  • Endurance Training increases the ability to sustain high quality athletic ability over time. The four components of endurance tr
    8·1 answer
  • The Hazard Communication Standard (HCS) requires that each container holding a hazardous chemical have a warning label that is e
    12·2 answers
  • Misha writes a lot of checks every month. Sometimes she records them in her check register, but other times she forgets. Which c
    14·2 answers
  • In what category does lettuce go into ? (protein, fat, carbs, or other )
    12·1 answer
  • What professional is likely to be involved in redesigning the workplace to reduce the risk of Carpal Tunnel Syndrome or any othe
    6·1 answer
  • Where is blood pressure lowest in the body?
    5·2 answers
  • The term that means “a person who chooses
    6·1 answer
  • It is an unfortunate truth that disabled individuals face challenges. Explain some of the challenges that an individual with a d
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!