All categories

3 years ago

What adaptations do desert plants have that allow them to survive with little rainfall

Biology

2 answers:

neonofarm [45]3 years ago

8 0

Plants have to save what little water they do get. Or they have to get water from their roots.

Scorpion4ik [409]3 years ago

3 0

The plants have deep roots. They adapted to little or no leaves. Or some plants live for one season.

If you want to learn for about dessert plant you can visit http://www.desertusa.com/du_plantsurv.html

Hope this helps!

You might be interested in

Best explains the process of energy conversion that takes place in the mitochondria

TiliK225 [7]

Mitochondria are the the powerhouse of the cell the convert enrgy all throughout it..

7 0

3 years ago

Can some one code this dna

cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand

TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand

GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand

GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand

AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0

3 years ago

The motion permitted at a joint ranges from ____________ , such as where some skull bones interlock at a suture, to ____________

Elenna [48]

The correct answers are no movement; extensive movement.
You cannot move the joints near your skull - at least now willingly - only a doctor can remove parts of your skull if you are undergoing a brain surgery. Otherwise, there is no movement at all there. However, when it comes to your shoulders, for example, you can move them at will in whichever way you want to.

3 0

3 years ago

Changing genes by taking in different genetic material

34kurt

- Can change in the structure of chromosome affect in health and development . These changes can affect many genes along the chromosomes and disrupt the proteins made from those genes.

_-_ hOpe that this really helpss youu well, and have a GREAT BRAINLY DAY .

3 0

3 years ago

Which scientist proved the existence of a virus as a new type of pathogen?

Readme [11.4K]

Answer:

Dmitri Ivanovsky

Explanation:

Dmitri Ivanovsky utilized one of these filters in 1892 to demonstrate that despite being filtered, sap from a diseased tobacco plant remained infectious to healthy tobacco plants. The filtered, infectious substance was dubbed a "virus" by Martinus Beijerinck, and this discovery is regarded as the origin of virology.

6 0

2 years ago