1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldenfox [79]
2 years ago
14

Predisposing factors associated with pyelonephritis include:.

Biology
1 answer:
Luden [163]2 years ago
8 0
Urinary obstruction, Neurogenic bladder, Catheterization, Pregnancy and diabetes
You might be interested in
A desire to conquer and exploit nature as quickly as possible is called ___
wariber [46]
Answer: Frontier attitude


5 0
3 years ago
Help pls!!!<br><br> Describe two ways to reduce air pollution and slow climate change.
Pepsi [2]
Plant trees because they absorbe co2
8 0
3 years ago
Read 2 more answers
What do frozen water drops become when they are carried back up into the sky by the wind and more layers of ice form on them?
Morgarella [4.7K]
The answer would be C. Hail.
3 0
4 years ago
Which ball will have thw greatest acceleration
o-na [289]
Hello!
I will need a image to properly answer this question.

Thanks!~
8 0
3 years ago
Which of the following describes melting?
melomori [17]
<span>When the molecules in a solid are heated (heat is the same as molecular movement) they move faster due to the energy gain and when they have enough energy they can overcome the attraction they have between each other and break their bonds to form a liquid, and if heated further a gas.</span>
4 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which hormone is largely responsible for women having wider hips than men?
    10·2 answers
  • Which of the following is a possible entire nucleotide found in a DNA molecule? (1 point)
    10·1 answer
  • Suppose that your friend is moving far away and describing his new location. He mentions that the area gets a lot of precipitati
    11·2 answers
  • Drugs are substances that produce physiological or psychological effects in humans. True False
    9·1 answer
  • As you watch the introduction sequence, list three abiotie, or nonliving factors in this ecosystem.
    6·1 answer
  • Someone please help.
    14·1 answer
  • The table provides data about the frequency of traits in a population over several generations,
    8·2 answers
  • Label the following statements as characteristics of the central or peripheral nervous systems:
    9·1 answer
  • What is the site of cellular respiration ?​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!