1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reika [66]
2 years ago
10

Phel

Biology
1 answer:
Nataliya [291]2 years ago
3 0

ANSWER: The codon is CAU.

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
A nurse observes a window washer falling 25 feet (7.6 m) to the ground. the nurse rushes to the scene and determines that the pe
natta225 [31]
The first thing that the nurse should do is TO START CHEST COMPRESSION.
Cardiopulmonary arrest refers to a sudden loss of blood flow, which occur as a result of the failure of the heart to actively pump blood. Performing chest compress on a victim of cardiopulmonary attack will help to restore the pumping function of the heart again.
4 0
3 years ago
What is the mitochondria
fgiga [73]

A part of the cell that controls the biochemical processes of respiration and energy production occur.

6 0
3 years ago
Read 2 more answers
During photosynthesis, the energy from sunlight is used to split water molecules. What happens to the hydrogen ions that are spl
dalvyx [7]
They build up in the thylakoid, where they bond to each other to create ATP.

Not 100% about this but that's what i got.
8 0
3 years ago
Which is the final electron receptor in the electron transport system of cellular respiration
Zepler [3.9K]

Oxygen is the final electron acceptor in the electron transport chain, which allows for oxidative phosphorylation. Without oxygen, the electrons will be backed up, eventually causing the electron transport chain to halt.

8 0
3 years ago
Other questions:
  • Which of the following is not a characteristic of all living things ?
    14·1 answer
  • Which of the following might result in a human zygote with 45 chromosomes?A) an error in either egg or sperm meiotic anaphaseB)
    14·1 answer
  • Which is an autonomic body function? squinting in the sunlight salivating at the thought of a hamburger raising your hand in cla
    9·2 answers
  • __is the five-carbon sugar found in DNA
    5·2 answers
  • What is the Earth's core made of
    8·2 answers
  • (EASY) Help help MEEE
    11·2 answers
  • I have the biology STAAR test tomorrow what facts and tips would help me pass it please help
    9·1 answer
  • O er ejemplo
    5·1 answer
  • The observable traits expressed by an organism are described as its
    9·1 answer
  • 50 POINTS! HELP :D!!!
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!