1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inysia [295]
3 years ago
11

Describe some ways that human activities are affecting aquatic ecosystems. Propose strategies that individuals can use and gover

nments can implement that would prevent or reduce these human impacts.
Biology
1 answer:
Art [367]3 years ago
5 0

Answer:

Humans are heavily polluting the waters in many areas with chemicals, medicine (for people), and garbage. A way that the government can help stop this issue is to have groups do routine cleanings of natural bodies of water along with prohibite the use of disposable items in the area like cups and/or bags.

Explanation:

You might be interested in
Which statement is true about the appendicular skeleton of the human body? A. It consists of two groups, the bones along the mai
Olin [163]

The correct answer is : C, It consists of two groups, the bones along the main axis and the bones that connect the limbs to the axial skeleton!

6 0
3 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
A scientist wants to test how much of an acid can be added to a solution
notsponge [240]

Answer:

<em>B. Methyl yellow, which changes from yellow to red around a pH of </em>

<em>4.0</em>

Explanation:

A pH indicator is a technique by which the pH of a solution can be known. The scenario in the question describes that the scientist wants to determine a pH after it gets converted from 6 to below 4. For this recognition, the scientist should use a methyl yellow indicator which will change from yellow to red once a pH around 4 is achieved.

8 0
3 years ago
Transpiration is the loss of oxygen through a plant’s leaves true or false
agasfer [191]

Answer:

in plants is responsible for the timing of seasonal activities such as flowering and growth.Transpiration is the loss of OXYGEN through a plant's leaves. False- water. When the guard cells of a leaf lose water, the stomata OPEN.

Explanation:

so the answer is True

4 0
3 years ago
Someone please answerrrr
Margaret [11]

Answer: Fortune tellers

Explanation:

8 0
2 years ago
Other questions:
  • Guys can you help with two questions?
    12·1 answer
  • Will partial budgets ever contain some fixed ownership costs
    15·1 answer
  • How can Lamarck’s theory be woven in knowing our understanding of genetics
    8·1 answer
  • Amoebic dysentery is caused by which of the following?
    5·2 answers
  • In 1987, 18 black-footed ferrets, the last known individuals of this species, were captured and brought into a captive breeding
    11·1 answer
  • The biomedical technique in which a part of the brain is destroyed with electric current is known as __________.
    15·2 answers
  • The distribution of related animals and plants across the world
    12·1 answer
  • Describe the relationship between DNA, chromosomes, and genes.
    7·2 answers
  • Match the type of boundary with its characteristics
    14·2 answers
  • 15) naturally occurring variations within a species are mainly the result of
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!