In an oligopoly type of market, there are only few producers whom dominate the market. This is the market type wherein there are only small number of firms that control the majority of the market share. The opposite to Perfect Competition, wherein there are unlimited number of producers. In an oligopoly, since there are only a few numbers competitors, each firm is likely to be aware of each other's action.
The answer to this question is "PERCEPTION". The term refers to the mental capacity that process of sorting out things, interpreting things mentally, analyzing things and conditions, and integrating stimuli from the sense organs and from the brain and later come up in a concrete and the sensible result after mental processing.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
These viral particles, also known as virions, consist of two or three parts: the genetic material made from either DNA or RNA, long molecules that carry genetic information, a protein coat, called the capsid, which surrounds and protects the genetic material.
