Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
Explanation:
archaea:they live in water area and usually eat some plants
bacteria:the germs that are in the air
eukarya:it is an animal well better said any animal because it has a cell membrane and nucleus to protect the cell
I am pretty sure that it is D
With decomposition, the final deposition of particles(sediments) usually occurs at the mouth of a stream. Then a process called horizontal sorting occurs where the sediments that were once carried down are arranged from big to small. Decomposition in streams takes time so the speed of the water and wind should not affect it nor should gravity or the direction. Streams cannot change direction either unless human involement occurs
Hope this helps :)
Answer:
A meter is a metric unit of length used worldwide by scientists to measure lengths and distances between objects.
Answer:
Most sedimentary rocks are formed in level layers. Therefore, the occurrence of tilted rock layers is evidence of mountain building. ... Tilting can also result when rocks are pushed upward, or uplifted. In some areas of the world, rock layers are so severely tilted that they may be bottom side up. Layered rocks form when particles settle from water or air. Steno's Law of Original Horizontality states that most sediments, when originally formed, were laid down horizontally. ... Rock layers are also called strata (the plural form of the Latin word stratum), and stratigraphy is the science of strata.
