1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erastovalidia [21]
2 years ago
11

What is globalization​

Law
1 answer:
WITCHER [35]2 years ago
5 0

Answer:

<h2>✨REAL ANSWER✨</h2>

Globalization is a global system that describes the interactions and changes that bind people, companies, governments, and nations around the world. It refers to the way information, products, services and capital flow between global societies.

You might be interested in
Yolanda and Rodney agreed that Rodney would paint Yolanda's home for $800, with Yolanda supplying the paint. Rodney went to Yola
Lady_Fox [76]

Answer:

Rodney should win the case because he showed up to do the work but Yolanda failed to perform her part of the contract (provide the paint).

The legal term used to describe Rodney's offer of performance is tender or attempted performance. In this case, Rodney (the promisor) went to Yolanda's house and offered to perform his painting services. Yolanda (the promisee) did not perform her part of the contract by not providing the paint, so the promisor was unable to perform. Since Rodney's non-performance was directly caused by Yolanda's non-performance, he is not liable for anything since Yolanda lost her rights because she breached the contract first.

3 0
3 years ago
Read 2 more answers
4. Which factor doesn't affect the Blood Alcohol Content (BAC)?
KATRIN_1 [288]
D. How physically fit you are
4 0
2 years ago
When driving on a four-lane highway and you turn right into a four-lane highway, right turn should be made from a :
Oksanka [162]

Answer:

The lane furthest to the right, or the furthest two lanes, depending on the road into either the first or second right lane depending on the road and the lane you are in.

Explanation:

7 0
2 years ago
To gain entrance to an Associates’ degree program for paramedics, which of the following courses are required?
TiliK225 [7]

Answer:

it b

Explanation:

6 0
3 years ago
Which factor would Anti-Federalists most strongly support?
Maslowich

Answer:

Anti-federalists insisted that a Bill of Rights must be included in the Constitution to protect individual's rights against a powerful central government.The anti-Federalists would most likely agree with the argument that government should tax only to raise money for its essential functions, which is from the Republican position on the economy.

6 0
2 years ago
Read 2 more answers
Other questions:
  • What was one major weakness of the Articles of Confederation?
    5·1 answer
  • What class license do you need to operate a boat?
    10·1 answer
  • Parole is _____.
    9·1 answer
  • The speaker argues that just because these men have been locked up, they shouldn't be locked out of their kids' lives. Do you ag
    8·1 answer
  • In what ways does the separation of powers weaken the government.
    12·1 answer
  • 5. Which of the following is the best definition of
    6·2 answers
  • Section 1 of the Sherman Act. The National Collegiate Athletic Association (NCAA) and the National Federation of State High Scho
    9·1 answer
  • How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
    15·1 answer
  • Which branch of government does the cartoonist suggest is the most powerful?
    5·1 answer
  • Someone help me find out his Mac 10 class
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!