All categories

2 years ago

5. Not all evidence is easily identified as evidence.

Biology

1 answer:

Degger [83]2 years ago

3 0

Answer:

True

Explanation:

Evidence is either implicict, or explicit. This means it is either easily identified or a connection can be made to provide the evidence.

You might be interested in

An owl has good night vision because its eyes can detect a light intensity as small as 5.0 × 10-13 W/m2. What is the minimum num

Lady bird [3.3K]

Answer:

Thus, the minimum number of photons per second is 77.34

Explanation:

Light intensity, $I_{min}$ = $5\times 10^{-13} W/m^{2}$

Pupil has a diameter, d = 8.5 mm

= 8.5 x $10^{-3}$ m

Radius of the eye, r = 4.25 x $10^{-3}$ m

∴ Area of the eye, A = $\pi .r^{2}$

= $3.14\times \left ( 4.25\times 10^{-3} \right )^{2}$

= $5.6\times 10^{-5} m^{2}$

Let $P_{min}$ be the minimum number of photons.

Therefore, $P_{min}$ = $I_{min}$ x A

= $5\times 10^{-13}$ x $5.6\times 10^{-5}$

= $2.8\times 10^{-17}$ W

Thus the minimum number of photons is given by

$N_{min}=P_{min}/E$

where E = $hc/\lambda$

= $\left (6.63\times 10^{-34}\times 3\times 10^{8} \right )/548\times 10^{-9}$

= $3.62\times 10^{-19} J$

Therefore, $N_{min}$ = $\frac{2.8\times 10^{-17}}{3.62\times 10^{-19}}$

= 77.34 photons per second

Thus, the minimum number of photons per second is 77.34

4 0

3 years ago

Which explains how winds cause waves?

ipn [44]

The answer is C
Friction between the blowing air and the water drags the water along and create waves

4 0

4 years ago

Type the correct answer in the box. Spell all words correctly.

Sunny_sXe [5.5K]

Answer:

Stormwater that cannot be directed back into rivers or streams is stored in <u>Retention Basin's</u>

Explanation:

3 0

3 years ago

Read 2 more answers

Identify two oral conditions related to nutritional factors

Lina20 [59]

Ill look for it hold on

8 0

3 years ago

Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU

coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0

3 years ago