1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
9

How do you find +/- std dev?

Biology
1 answer:
anygoal [31]3 years ago
7 0
I think for your distilled water of 1 it would look like 27.8 +/- 5 because you can go 5 above or below your average and 2 would be 27.8 +/- 10 because you can go 2 times below or above your average?
You might be interested in
On which part of the compound light microscope are specimens placed for viewing?
julia-pushkina [17]

Answer: D

Explanation:

6 0
3 years ago
Read 2 more answers
12. The ability of Carbon to form up to 4 bonds is important to living organisms in that it allows Carbon to
givi [52]

Answer:

D, form rings and chaines i think

Explanation:

This allows the Carbon to form long chians with elements such as hydrogen and phosphorus, etc, used some info from this site

https://courses.lumenlearning.com/wm-nmbiology1/chapter/carbon-and-carbon-bonding/

if my answer helps please mark as brainliest.

8 0
3 years ago
Why must everything but the independent
Maurinko [17]

Answer:

A: since a graph can only hold one variable

Explanation:

Hopefully this helps!

8 0
3 years ago
The sympathetic nervous system releases epinephrine to indirectly______.
ivann1987 [24]
The sympathetic nervous system releases two hormones within the body in response to stress, resulting in an adrenaline rush or a sense of urgency that occurs during stressful conditions. These hormones are called epinephrine. So it releases hormones to give you adrenaline in a bad situation or stressful one
6 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • What symbiotic relationship is leech and alligator?
    8·1 answer
  • In a stringed musical instrument, the sound frequency of a particular string can be increased by
    12·2 answers
  • The largest organ in the body is the _______.
    6·2 answers
  • How would you expect prey to respond to a predator they have never encountered before (a novel predator)? explain your reasoning
    13·2 answers
  • What are the waste products of respiration
    14·2 answers
  • Which description is incorrect for the layers of the heart and its serous membranes?
    8·1 answer
  • Both plants and animals have these organelles to store and pass on genetic information
    10·1 answer
  • Which 3 of the following are the main ideas of the Cell Theory?
    11·1 answer
  • During what phase is the cell polyploid? Why is it polyploid at this point--what has happened to create this state and why is it
    8·1 answer
  • Everything including you and me is made up of matter<br> True or False
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!