1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
matrenka [14]
3 years ago
5

Which is NOT connective tissue? A. Bones B. Fat C. Blood D. Neurons

Biology
2 answers:
ipn [44]3 years ago
8 0
C. Blood has there own cells which moves around which has nothing connected to tissue
Anarel [89]3 years ago
3 0
The answer is C.blood because bones are connected to tissues. Fats are near tissues and the neurons can be found inside the tissue. Hope this helps.
You might be interested in
I need all the letters <br> Please hurry I need help plssss
ValentinkaMS [17]

Answer:

A is T

B is phosphate

C is C

D is sugar

E is T

F is Hydrogen Bond

Explanation:

5 0
4 years ago
Is a banana a fruit berry or vegetable​
Jobisdone [24]

Answer:

Raspberries are Not. It turns out berry is actually a botanical term, not a common English one. It turns out that blackberries, mulberries, and raspberries are not berries at all, but bananas, pumpkins, avocados and cucumbers are.

Explanation:

hope it helps

8 0
3 years ago
Read 2 more answers
The Theory of spontaneous generation was?
Kay [80]
It was the theory that an organism could form from something such as mud for an example.
3 0
3 years ago
Read 2 more answers
The corticospinal tract, the corticobulbar tract, and the rubrospinal tract make up the ______________ of descending tracts from
wolverine [178]

Answer:

corticobulbur

Explanation:

i think this is the answer

7 0
3 years ago
Which of the following is NOT a
Lostsunrise [7]
D. Applying fertilizer granules to your yard
3 0
3 years ago
Read 2 more answers
Other questions:
  • Gotta have this study guide done for tomorrow
    12·1 answer
  • Sometimes a new experimental result may seem to go against a well-established scientific theory. Which statement BEST describes
    12·1 answer
  • 5.which of the following organelles is the control center of a cell?
    8·1 answer
  • In which situation would the heterozygous phenotype be somewhere between (a blending of) the two homozygous phenotypes? a) co do
    6·1 answer
  • How can you help the bees​
    12·1 answer
  • According to the Milankovitch Theory, three cycles combine to affect the amount of solar heat that’s incident on the Earth’s sur
    10·1 answer
  • 3. A living thing made of many cells is called a<br>organism.​
    14·2 answers
  • What happens when the density of the object is equal to the density of the fluid.
    5·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • The model show's a portion of a DNA strand. What does the pentagon represent in the model?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!