1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
12345 [234]
4 years ago
5

Witch label identifies the part of the ATP molecule that changes when energy is releases in the cells of all living things and w

hat is the name of this process
Biology
2 answers:
Zepler [3.9K]4 years ago
6 0

Not sure what you mean by "witch label" but energy is released from ATP when one of the three phosphates is separated from the rest, converting ATP into ADP and releasing energy. I believe the process is just called ATP hydrolysis although there may be a term I'm unaware of.

dusya [7]4 years ago
6 0

• When the bond present between the two phosphate groups breaks down, it releases energy.

• In a living cell, energy is released to perform many essential metabolic activities; the process is called respiration.

Further Explanation:

Respiration is a biochemical reaction that breaks down the molecule of glucose and then produces ATP. The different stages of cellular respiration are:

• Glycolysis

• Pyruvate oxidation

• Krebs cycle

• Oxidative phosphorylation

Glycolysis converts the glucose molecules to pyruvate molecules, and it is the initial step of cellular respiration. It can occur in the present as well as in the absence of oxygen. This process converts glucose molecules to pyruvate molecules. During this process, there is a net release of ATP (produce energy in a living cell) and NADH molecules.

The ATP is synthesized due to the occurrence of a proton gradient across the inner membrane of mitochondria. Synthesis of ATP is possible in the membrane only if the proton gradient is well established; any leakage in the membrane will disturb the gradient and directly affect the ATP synthesis.ATP consists of three phosphate groups; when the bond between the phosphate groups breakdowns, it releases energy. The energy released in the body help in metabolic activity.

Learn more:

1. Learn more about cell organelle brainly.com/question/5923583

2. Learn more about the diffusion brainly.com/question/1386629

3. Learn more about the plant brainly.com/question/862697

Answer Details:

Grade: High School

Subject: Biology

Chapter: Cellular metabolism

Keywords:

Oxidative phosphorylation, living cell, metabolism, proton gradient, ATP, NADH, metabolic activity, phosphate group, released energy.

You might be interested in
Technology can have good and bad effects. What is a bad effect of spraying pesticides on crops with the use of airplanes?
Anastaziya [24]

The correct answer is option a, that is, It is sometimes sprayed too far from the crops.

The use of pesticides on crops may exhibit a significant threat to the environment, mainly in and nearby to water sources with sensitive ecosystems, sources area, public drinking water, residential areas, and recreational waters.  

Aircraft spray of pesticides takes place from a greater altitude than the ground-based equipment and on a major scale, both of these elements may enhance the threat of spray drift.  


6 0
3 years ago
Read 2 more answers
deforestation the chopping down of large numbers trees for human use is considered to have a negative impact on climate change.
Rudiy27

Answer:

Plants take in carbon dioxide from the environment for photosynthesis. Because trees are large, they need a lot of energy, which likely results in a lot of carbon dioxide being removed from the air. If they’re chopped down, there will be fewer trees to remove the extra carbon dioxide from the air.

Explanation:

answer from Plato

6 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Pollen is produced in structure H through the process of​
Rudiy27

Answer:

Meiosis

Meiosis is the process involved in the production of pollen or male sex cells in an angiosperm flower.

Explanation:

4 0
4 years ago
A blood platelet drifts along with the flow of blood through an artery that is partially blocked by deposits. As the platelet mo
pogonyaev
B. Less pressure because it’s going from high pressure to low pressure
3 0
3 years ago
Other questions:
  • Air pollution is caused by  A. the sun.  B. heavy rainfall.  C. natural events and human activities.  D. human activities bu
    14·2 answers
  • Which tool can be used to determine the volume of a metal bolt?
    14·1 answer
  • The scientific method is a series of organized steps someone takes in order to solve a. It is broken down into a series of logic
    6·2 answers
  • The relationship between heredity and environment is
    9·1 answer
  • How are earth's organisms and crust interdependent? read more &gt;&gt;?
    7·2 answers
  • The two types of cell cycle genes that, if mutated, cause cancer cells to divide uncontrollably are called tumor suppressor gene
    8·1 answer
  • What did Lamark believe about evolution? Why is this not correct? What is the first common evolution misconception? What does ev
    15·1 answer
  • According to modern scientific theory, which of the following organisms appeared first?
    8·1 answer
  • The ______________________ picks up whole and partial neurotransmitters from the synaptic gap and brings them into the terminal
    14·1 answer
  • This movement requires ____________ proteins (pumps) and energy in the form of _______________.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!