1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pepsi [2]
2 years ago
7

Withdrawals of large amounts of groundwater in areas

Biology
1 answer:
vredina [299]2 years ago
6 0

Answer:Intrusion of salt water

Explanation:

You might be interested in
Help please with a cherry on top
Veronika [31]

Answer:

text 1 - while we may know what's coming ahead of time, weather remains unpredictable

text 2 - the coastal regions experience the most damage...

text 3 - modern technology utilises energy to predict...

text 4 - hurricanes are intensely powerful storms that are only growing more intense

text 5 - meteorologists can make predictions of hurricane movement...

5 0
2 years ago
What do all vertebrates and invertebrates have in common?
lara [203]
They actuallty both some type of animal in it ,
6 0
3 years ago
Read 2 more answers
When did Cyanobacteria start producing pure oxygen
Travka [436]

<u>Answer:</u>

Cyanobacteria start producing pure oxygen around 200 million years ago.

<u>Explanation:</u>

Many scientists believed that Earth did not have any oxygen. Cyanobacteria or the blue green algae are the microbes which produced oxygen for the first time with the help of photosynthesis.  This was around 4.5 billion years ago: after Hadean eon.

They were very simple, but they produced oxygen in the early earth’s atmosphere. So, they brought evolution on earth. This “blue-green algae” exists in salt water, rocks and soils and play a major role in maintaining the ecosystem.

3 0
3 years ago
Read 2 more answers
Structural protein found in skin and connective tissue:
Charra [1.4K]
Collagen is the structural protein found in skin and connective tissue. This protein is the most abundant protein, that makes up one-third of the protein in the human body. The function of this protein in the skin is to give the skin strength and elasticity, and to  replace dead skin cells. In connective tissues it s<span>upports structures and anchor cells to each other.</span>
3 0
3 years ago
A cell created by cloning is genetically
Mama L [17]

Answer:

A) identical to its parent

Explanation:

It was produced through asexual reproduction.

7 0
3 years ago
Other questions:
  • If parents supplied different alleles for a certain trait to their offspring, What following terms would be used to describe the
    14·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Which nucleotide could be inserted as a mutation in the sequence A—G—A—T—G—C—G—A—G—T—T—A—C—G—G? A. adrenal B. cytosine C. grauti
    14·2 answers
  • What are the forces that struggle in the plot of a story?
    9·1 answer
  • TRUE/FLASE the function of DNA is to store genetic material ( please help its due right now )
    13·1 answer
  • Why does the mass of a substance remain the same after a chemical reaction
    6·1 answer
  • Give two reasons of the modification of stem of a plant in different forms,
    5·1 answer
  • Could someone help me with this please
    13·2 answers
  • How was your eye color determined
    14·1 answer
  • The gene theory declares that all organisms contain coded information in __________ which dictates the form and function of orga
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!