1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elden [556K]
3 years ago
11

Why are decomposers important? How do they affect you?

Biology
1 answer:
Alexandra [31]3 years ago
5 0

Answer:

The main role of the decomposer in any ecosystem is to recycle nutrients once organisms die and recycle nutrients in waste.

You might be interested in
What is the greatest saeamoid in animals<br>​
sergeinik [125]

Answer: In the knee—the patella (within the quadriceps tendon). This is the largest sesamoid bone. In the hand—two sesamoid bones are commonly found in the distal portions of the first metacarpal bone (within the tendons of adductor pollicis and flexor pollicis brevis).

Explanation:yw

5 0
3 years ago
How are apple trees classified?
stealth61 [152]

Answer:

by their species or genus

Explanation:

4 0
3 years ago
Read 2 more answers
Drinking alcohol during pregnancy negatively impacts development of the fetus because
Sphinxa [80]

Answer:

Drinking of alcohol during pregnancy negatively impacts development of the fetus because it could lead to Fetal Alcohol Spectrum Disorders.

Explanation:

brainly.com/question/13395282

6 0
2 years ago
Read 2 more answers
Which excersise involves abrupt explosive movement
RoseWind [281]
I would say maybe dance? Because in Hip Hop there are very sharp and abrupt movements.
Hope this helped! :-)
4 0
3 years ago
Interestingly, before birth GABA functions as an excitatory neurotransmitter for certain neurons in the developing brain, meanin
Vsevolod [243]

Explanation:

Γ-Aminobutyric acid (GABA) is a non-protein amino acid that is widely present in microorganisms, plants and animals. It is the main inhibitory neurotransmitter in the central nervous system (CNS) of mammals.

It plays the leading role in reducing neuronal excitability throughout the nervous system. In humans, GABA is directly responsible for the regulation of muscle tone.

Although, in chemical terms, it is an amino acid, in the scientific and medical communities they rarely refer to GABA as such because the term "amino acid" by convention refers to the α amino acids and GABA is not. It is also not considered as part of any protein.

In spastic diplegia in humans from an early age, GABA absorption is negatively affected by the nerves damaged by the lesion in the upper motor neurons characteristic of the condition which leads to the development of muscular hypertonia signaled by those nerves that are incapable of absorbing GABA.

7 0
3 years ago
Other questions:
  • What is overproduction?
    12·2 answers
  • How can the body of an animal stay healthy
    13·2 answers
  • All of the following are possible sources of error in a scientific investigation except for
    13·2 answers
  • In a particular recessive genetic disorder, you find the allele frequency for this recessive allele in a population is 0.02. Ass
    10·1 answer
  • Which phase of mitosis is the cell most likely in when a cell is found to have two nuclear envelopes and spindles that appear to
    5·1 answer
  • Which statements correctly describe mutations in gametes and mutations in somatic cells?
    7·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Can we release DMT while awake?
    15·1 answer
  • Question 1
    9·1 answer
  • Can plant cells change shape
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!