1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldenfox [79]
3 years ago
6

Caregivers who suspect resident abuse are expected to __________.

Biology
1 answer:
Anton [14]3 years ago
7 0
E. All of these answers are correct
You might be interested in
An electrocardiogram is a test that doctors use to assess cardiovascular health. The image below shows data given by an electroc
quester [9]
The answer is A. An electrocardiogram (EEG) measures the electrical activity of the heart to see if there’s any irregularities in the heartbeat. Irregularities in your heartbeats can be caused by many things including blockages which can cause strokes and heart attacks. It’s a good idea for students or any athletes to get an EEG as part of their physicals to rule out any heart issues.
8 0
2 years ago
Read 2 more answers
According to Piaget, children have acquired the cognitive skill of conservation when they're able to
Solnce55 [7]

Answer:

The right answer is D: realize that the term heavy describes an object one way and the term big describes it another way.

Explanation:

The studies of Piaget suggested that when a child is born, his brain if of a very basic kind of structure. He did not agree with the idea that intelligence is a pre-determined trait and in contrast he said that during the process of child's growth and development, when the interaction with environment occurs, his cognitive abilities also grow.

When the child is able to realize that term heavy describes an object one way and the term big describes it another way, that is the point when , children have acquired the cognitive skill of conservation.

Hope it help!


3 0
3 years ago
What is the importance of crossing-over?
nikklg [1K]

Answer:

b.It increases the likelihood that daughter cells contain different genetic material.

Explanation:

Morgan and Cattell for the first time used the term ‘crossing over’.  Crossing over takes place during prophase I of meiosis. During crossing over, chromosome segments of non-sister chromatids of homologous chromosomes get exchanged. As a result, the daughter cells acquire different genetic materials. Thus, it provides genetic variation by creating a new combination of genes or get recombination and produces hybrids.

3 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
How does intestinal failure affect the body? carbon dioxide builds up in the body. carbon dioxide builds up in the body. energy
ratelena [41]

Answer:

Its energy is not given to body

Explanation:

Intestinal failure is basically like where your intestines is slow and has no energy.

5 0
1 year ago
Other questions:
  • If an object is moving with a force of 99N at 12.5m/sec2, what is the mass of this object?
    7·1 answer
  • The Cenozoic Era follows the end of the _______ period.
    6·2 answers
  • The father of a 2-year-old phones the emergency department on a sunday night and informs the nurse that his son put a bead in hi
    5·1 answer
  • Explain how meiosis accounts for the distribution of alleles to gametes
    14·1 answer
  • Which of the following are signs and symptoms of dengue fever
    10·1 answer
  • Which of the following is not a role of water in the body? boosts the immune system lubricates tissues and joints forms essentia
    14·1 answer
  • A polygenic trait is controlled by
    13·2 answers
  • How are photosynthesis and cellular respiration related? O A. Cellular respiration is the process animals use to produce glucose
    11·2 answers
  • List three examples of single celled eukaryotes.
    11·1 answer
  • I WILL GIVE BRAINLIEST
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!