1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
3 years ago
5

Diffusion always causes particles to move from a reigon of what concentration

Biology
1 answer:
alexandr402 [8]3 years ago
8 0
Always high-to-low concentration for diffusion. I hope I helped ^u^
You might be interested in
Which came first the chicken or the egg
mart [117]
Prior to the first true chicken, there were non-chickens. The DNA changes came about in cells housed in the egg. So the egg came first. In July 2010, British scientists, using a supercomputer, claimed to have come up with the final and definitive answer.


I hope it helps
5 0
2 years ago
Read 2 more answers
When a single parent simply replicates its DNA and then divides, what occurs?
kykrilka [37]

Answer:

A cell division

Explanation:

6 0
3 years ago
Describe whether high blood pressure is because of nature, nurture or both
VMariaS [17]

Answer:

Both

Explanation:

Nature is a unexpected thing but with nurture you can also get it by nurturing your self or someone badly

5 0
1 year ago
The pathway water takes to reach the xylem cells in which it passes through each cell of the cortex is the ___ route. intracellu
stealth61 [152]
A. Intracellular
The pathway water takes to reach the xylem cells in which it passes through each cell of the cortex is the intracellular route.
5 0
3 years ago
In the investigation of oxygen dynamics in E. chlorotica cultures,
Oksana_A [137]

Answer:A

Explanation: Teacher gave me the answer

3 0
3 years ago
Other questions:
  • Why are there so many do breeds?
    12·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of the following best describes a nucleotide? A. a nitrogen base and a five-carbon sugar only B. a five-carbon sugar, a ph
    10·1 answer
  • Which of these represents the condensation in the water cycle?
    10·2 answers
  • All isotopes of technetium are radioactive, but they have widely varying half-lives. If an 800.0 g sample of technetium-99 decay
    8·1 answer
  • Which of the following are produced from photosynthesis?
    13·1 answer
  • What are the reactants and products of photosynthesis.
    14·1 answer
  • What is the full account of yeast​
    5·1 answer
  • Because copper is a metal, it is *
    11·1 answer
  • All organisms on the top of an energy
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!