1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kondor19780726 [428]
2 years ago
8

Do you think the amount of foam in the glasses will differ? write down your prediction.

Biology
1 answer:
neonofarm [45]2 years ago
6 0

Answer:

The formation of foam is a process when the small bubbles of the gas get trapped inside a solid or a liquid a form is made and gets made by the tapping of millions of small bubbles and can be seen in marshmallows. The process of foam formation is thus through a dispersed medium and in general gas is present.

The foam is thus evidence that respiration, is taking place as carbon dioxide is a product of respiration.

Explanation:

You might be interested in
Witch is the site of the most ATP production during cellular respiration
mihalych1998 [28]

I don't know how specific you need to get for this question. The basic answer would be the mitochondria as it is where the Krebs Cycle, the Electron Transport Chain, and Chemiosmosis (also referred to as oxidative phosphorylation) all occur. Chemiosmosis is where the majority of ATP is produced during cellular respiration, and it primarily occurs in the matrix of the mitochondria as protons move down the gradient through ATP Synthetase channels.

6 0
4 years ago
Name two categories used to classify properties of matter
Igoryamba
The two  cateogaries of matter are intensive and extensive.


 hope it helps u......
7 0
4 years ago
Name and describe 4 ways animals use energy
AlladinOne [14]
Thinking, moving, growing, keeping warm, reproducing, looking listening
5 0
4 years ago
What is intramembranous ossification? What is intramembranous ossification? the formation of bone from preexisting hyaline carti
Aneli [31]

Answer:

The correct option is formation of bone from within fibrous membranes.

Explanation:

The process of intramembranous ossification results in the production of bones from the fibrous membranes. The mesenchymal cells get differentiated into different kinds of osteoblasts. The process of intramembranous ossification occurs in the skull. In other parts where bones are to be formed by this process, the mesenchymal cells get converted into cartilage first. The cartilage will then be converted or replaced into bones.

Bones at the base of the skull and the long bones are produced by endochondral ossification.

5 0
4 years ago
Compare and contrast the soil in the desert to the soil in the rain forest
Zinaida [17]

Soils of the Tropical Rain forests. Soils here tend to be deep because the warm temperatures and often high rainfall lead to strong weathering of the parent rock to form soil. They tend to be reddish in color because of the way that the iron minerals in them respond to the hot climate. hope this was helpful <3

6 0
4 years ago
Other questions:
  • Which of the following physical characteristic(s) is/are associated with human females?
    7·1 answer
  • Second-generation antipsychotic drugs bind to dopamine receptors and _____ receptors
    9·2 answers
  • Chromosomes reach the poles of the cell during metaphase
    7·1 answer
  • A light-year is a unit of ________.<br> A. time<br> B. distance<br> C. volume in space
    13·1 answer
  • All organisms require nitrogen to make amino acids, which in turn are used to build what?
    11·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Someone help me with this
    10·1 answer
  • Fibrocartilage is designed to withstand repeated compressive forces. Fibrocartilage is designed to withstand repeated compressiv
    8·1 answer
  • Before herbivores can move into an ecosystem
    10·1 answer
  • What are the functions of proteins in cells and viruses?​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!