Answer:
The answer is B: The child will likely have Tay-Sachs disease if both parents pass on the dominant alleles.
Explanation:
Brainliest pls!!
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer: Density-dependent limiting factors
AN-PEP enzyme refers to a dietary supplement, which has been shown to dissociate gluten in the stomach. It has been proven to help the individuals suffering from Gluten sensitivity or Celiac disease. The scientific name of the enzyme is Aspergillus Niger prolyl endoprotease.
However, certain structural differences would take place between AN-PEP, which prevent the enzyme from digesting the peptides. Some of the differences like amino acid differences would be expected in the active site, and in the regions, which influence the folded composition of the active site.
