A genotype is determined by your genes and a phenotype is by your physical features
Answer:
C
Explanation:
because there is not enough surface area to grow more
Viruses are made up of DNA
Answer: Humans and greater primates excrete water, broken down proteins and Urea. Many things cause unusual urine, Urea gives urine its yellow color a lack of urea can mean kidney failure. however it's hard to tell a lack of urea by just looking at urine as drinking excessive amounts of water turns the color clear and drinking caffeine turns the color reddish or brown so lab testing must be done
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.