1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
In-s [12.5K]
2 years ago
9

Based on information from the periodic table, what does this image represent?

Biology
1 answer:
Artyom0805 [142]2 years ago
8 0
Beryllium. The image represents beryllium.
You might be interested in
What is a difference and similarity of genotype and phenotype?
NemiM [27]
A genotype is determined by your genes and a phenotype is by your physical features

6 0
3 years ago
NEED HELP ASAP !!!!!!!!!!!!!!
Lesechka [4]

Answer:

C

Explanation:

because there is not enough surface area to grow more

7 0
2 years ago
What are viruses made up of
sukhopar [10]
Viruses are made up of DNA
8 0
3 years ago
Read 2 more answers
g In humans and higher primates, _____ is the final product of purine base catabolism and is excreted in urine. However, its ina
GaryK [48]

Answer: Humans and greater primates excrete water, broken down proteins and Urea. Many things cause unusual urine, Urea gives urine its yellow color a lack of urea can mean kidney failure. however it's hard to tell a lack of urea by just looking at urine as drinking excessive amounts of water turns the color clear and drinking caffeine turns the color reddish or brown so lab testing must be done

8 0
3 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
2 years ago
Other questions:
  • From the end of the small intestine, the segments of the large intestine, in order, are:
    9·1 answer
  • Help <br> Nucleic acid <br> Certain protein<br> Cell membranes<br> Certain carbohydrates
    11·1 answer
  • Increasing muscle mass and decreasing fat content in your body can increase ones use of energy. Why is this?
    12·1 answer
  • The ideal gas constant, R has several different values that could be used. Which quantity causes these differences ?
    15·2 answers
  • The _____ is a sac-like organ located between the esophagus and small intestine most digestion begins here
    9·1 answer
  • The part of a. Soundwave that we hear as loudness is
    5·1 answer
  • What organelle is labeled E? <br><br> Need help on this question
    12·1 answer
  • 10. Scientists use tools to ___?
    7·1 answer
  • PLEASE HELP QUICK, 100 POINTS AND BRAINLIST.
    6·2 answers
  • Compare the Early Earth's Atmosphere to today's Atmosphere. What change in the atmospheric conditions impacted life on earth the
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!