1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Amiraneli [1.4K]
2 years ago
8

Scientists classifying modern animals are most likely to compare the -

Biology
1 answer:
MrMuchimi2 years ago
5 0

Answer:

F. The sequence of an animals' DNA is how scientist classify modern animals

You might be interested in
A secondary consumer eats
Yuki888 [10]
Its either dead material or organisms that eat producers
4 0
3 years ago
How does magma form rocks that look smooth and glassy
algol13

Answer:

Magma that flows then cools on the earth's surface fast enough that there is no time for any crystals to form on the rocks and are as smooth as glass.

Explanation:

8 0
2 years ago
If an Arctic polar bear is transferred to a zoo in tropical Singapore, it will not be able to survive. What could be the reason
andrew11 [14]
A, because its thick fur is designed to keep it warm, it would over heat and unfortunatly die
6 0
3 years ago
Read 2 more answers
Pacemakers maintain the heartbeat in people who suffer from certain defects. The function of an artificial pace is to send elect
tia_tia [17]
Abnormal heart rhythms?
4 0
3 years ago
Read 2 more answers
How does a cells surface area change compared to its volume when the cell grows
EastWind [94]

Answer:

As a cell grows bigger, its internal volume enlarges and the cell membrane expands. Unfortunately, the volume increases more rapidly than does the surface area, and so the relative amount of surface area available to pass materials to a unit volume of the cell steadily decreases.

5 0
2 years ago
Other questions:
  • Can you help me with this bio questions
    10·2 answers
  • The ________ perspective on sexual deviance stresses the point that social life revolves around varying definitions of reality a
    14·1 answer
  • Chief cells secrete inactive pepsinogen in order to prevent acid erosion inside of the chief cells. True or False
    9·2 answers
  • Analyzing yourself crossing the finish line and how are you feeling
    9·1 answer
  • What disease of the nervous system is also referred to as water on the brain?
    15·1 answer
  • a spaceship is designed to support animal life for a multiyear voyage to the outer planets of the solar system. plants will be g
    10·1 answer
  • What causes a movement between the land in the ocean
    14·1 answer
  • If two parents both share purebred recessive traits, what’s the probability of their offspring having a dominant trait?
    7·1 answer
  • What percentage of the organisms reproduce asexually?
    7·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!