1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
murzikaleks [220]
3 years ago
15

The caribbean monk seal was declared extinct in 2008. although there are other types of seals on earth, caribbean monk seals cou

ld only breed with other caribbean monk seals. a caribbean monk seal in an enclosure. the last caribbean monk seal that died was the last member of a species. a community. a biome. an ecosystem.
Biology
1 answer:
Bezzdna [24]3 years ago
4 0

The last Caribbean monk seal that died was the last member of a species.

Option A.

<h3>What is caribbean monk seal?</h3>

Generally, The Caribbean monk seal is also known as Neomonachus tropical is is an extinct seal is found in the Caribbeans.

In conclusion, The animal species went extinct in 2008.

Read more about Animal

brainly.com/question/11957660

You might be interested in
The Great Pacific Garbage Patch is an area in the north Pacific ocean that contains trash and causes harm to ocean life and thos
lubasha [3.4K]

Answer:

See the answer below

Explanation:

<em>The lessons that can be learned from this floating pile of trash is that indiscriminate disposal of waste into the environment by humans can eventually come back to haunt them.</em>

What led to the floating pile of trash is the indiscriminate disposal of wastes into the environment. These wastes eventually find their way to the ocean, damaging the aesthetic appearance of the water, poisoning aquatic biodiversity, and eventually poisoning the humans that consume the aquatic foods that make it out of such water alive.

8 0
3 years ago
What's the purpose of transcription for DNA?
Marianna [84]

Answer:

bang tan? aka bts? right

5 0
3 years ago
The three basic principals of training that are the foundation for developing a successful personal fitness program are ________
Oduvanchick [21]
1. Overload
2. Progression
<span>3. Specificity</span>
3 0
3 years ago
PLEASE HELP ASAP!!!!To assess the value of a work of art, an appraiser must consider the artist's skill and reputation, as well
Harlamova29_29 [7]
<h2><em>D. Determine valu</em></h2><h2><em>I took the test (I got a A btw)</em></h2>
3 0
3 years ago
A new microorganism is isolated from a lake and is placed into a solution of KCl. The voltage difference across its membrane is
Leona [35]

Answer: \Delta U= 1.922x10⁻²⁰ Joules

Explanation: <u>Electric</u> <u>Potential</u> <u>Energy</u> (U) is the energy a charged object has due to its location in an electric field and it will only exist with the object is charged.

<u>Voltage</u> or <u>Electric</u> <u>Potential</u> <u>Difference</u> (V) is external work done to move a charge from one point to another in a electric field.

These terms have a relationship, which is given by:

\Delta U=q\Delta V

where

q is the charge

Proton is positive and has a charge of 1.6x10⁻¹⁹C.

Unit for potential energy is Joule (J). The relation between mV and J is

1mV = 10⁻³J

Then:

V = 120x10⁻³

V = 0.12

So, for a proton to move from the negative side of a membrane to the positive:

\Delta U=q\Delta V

\Delta U=1.6.10^{-19}.0.12

\Delta U = 1.922 x 10⁻²⁰

Energy necessary to transport a proton from negative side of the membrane to the positive is 1.922 x 10⁻²⁰J.

4 0
3 years ago
Other questions:
  • More men die in middle age from ______ than from any other cause.
    11·2 answers
  • Select all that apply.
    11·1 answer
  • The Venn diagram compares aerobic respiration and anaerobic respiration. mc024-1.jpg Which statement should be categorized only
    10·2 answers
  • If two gray mice mated, what percent of their offspring would have pure white fur?
    11·2 answers
  • What was the independent variable in this experiment? Help
    8·2 answers
  • A herbaceous plant has
    12·1 answer
  • How can competition limit a populations growth
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Explain why a bone is referred to as a living tissue?​
    10·2 answers
  • Why do malleable and ductile physical properties help make minerals useful? Pls answer with a simple/easy to understand answer
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!