1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bixtya [17]
2 years ago
9

Antibiotics significance

Biology
1 answer:
I am Lyosha [343]2 years ago
5 0

Answer:

To detox or get away of all the fluids that may affect your skin by pimples and staff.

You might be interested in
What is the mass percent of hydrogen in ammonium phosphate, (NHÁ)ÀPOÁ?
Black_prince [1.1K]
The chemical formula of ammonium phosphate is (NH4)3PO4. There is 3*4=12 Hydrogen atom in one molecule ammonium phosphate. The total mass of one molecule is (14+4)*3+31+16*4=149. The mass of hydrogen atoms in one molecule is 3*4=12. So the mass percent of hydrogen is 12/149*100%=8.05%
6 0
3 years ago
The iris in the human eye contracts and expands, controlling the amount of light that reaches the retina. What types of muscle c
saveliy_v [14]

Answer:smooth and involuntary

Explanation:the sphincter papillae are muscles responsible for narrowing the pupil, while the dilator papillae makes the pupil larger. Both of them are smooth types of muscles, that are controlled by nerves, sending signals from the brain about the light conditions.

3 0
3 years ago
Describe and define some aspect of exocytosis or endocytosis?
Sav [38]

Answer:

Exocytosis: It is defined as the process of membrane-bound vesicles fusing with the plasma membrane and later releasing their contents to the extracellular part of the cell.

Endocytosis: It is defined as the process of capturing a particle from outside the cell by the engulfing process with the cell membrane. It is basically two types:

1) Pinocytosis: Cellular drinking.

2) Phagocytosis: Cellular eating.

8 0
3 years ago
Glycolysis results in a net gain of ____ atp molecules.
il63 [147K]

Answer:

As glycolysis proceeds, energy is released, and the energy is used to make four molecules of ATP. As a result, there is a net gain of two ATP molecules during glycolysis.

Explanation:

two atp molecules

5 0
2 years ago
Is genetic material found in plant cells, animal cells, or prokaryotic cells?
scoray [572]
Genetic material is found in Eukaryotic cells. Plant and animal cells both are eukaryotic cells.
4 0
3 years ago
Other questions:
  • Enzymes 2) Enzymes A) are composed of long chains of fatty acids. B) can be destroyed by variations in temperature or pH. C) are
    15·2 answers
  • 20. Unlike monocots, dicots have
    11·1 answer
  • Where are earthquakes and volcanoes most likely to occur
    12·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which of the following is an advantage of single cell recordings
    11·1 answer
  • How does putting salt on frozen roads make the roads less icy?
    10·2 answers
  • A geothermal power plant can be used to generate electricity
    8·1 answer
  • What organelles are most directly involved in transporting materials out of the cell?
    12·1 answer
  • GIVING BRAINLIEST AND THE REST OF MY POINTS!!!!!!!
    10·2 answers
  • __________ is the principle of dealing with environmental problems without discriminating against people based upon socioeconomi
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!