1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Darina [25.2K]
3 years ago
8

When did most marine life go extinct?

Biology
1 answer:
irinina [24]3 years ago
8 0
252 Ma<span> (million years) 
Please give brainliest

</span>
You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
The attachment of nucleotides to form a complementary strand of DNA during replication
olga2289 [7]

Answer: is accomplished by DNA polymerase.

Explanation: DNA polymerase is an enzyme that catalyzes the synthesis of a complementary strand of a DNA molecule during replication. The double stranded DNA helix is first unwind by the enzyme known as helicase giving rise to two DNA strands which serve as templates for replication. DNA polymerase then binds to a primer, a short nucleotide sequence and catalyzes the attachment of nucleotides to the primer to form a growing strand that is complementary to the parent DNA.

6 0
3 years ago
Which list BEST identifies how the arrows should be arranged around the paper leaf in
Nataly [62]

Answer: D

Explanation:

During the process of photosynthesis the plant would use carbon dioxide, sunlight and water in order to produce and release sugar and oxygen back into the air.

6 0
3 years ago
How do sound waves travel?
Dmitriy789 [7]

Answer:

A

Sound waves radiate outward from a central point.

3 0
3 years ago
Read 2 more answers
Use the words in the word bank and arrows you draw to complete the diagram so it tells how the Sun provides the energy that driv
SSSSS [86.1K]

The correct flowchart is energy - > atmosphere - > air pressure - > convection - > global winds. This is a very simple process as explained.

<h3><u>Explanation:</u></h3>

The energy from the sun actually heats up the land surface and the water surface of the earth. As the land gets heated up, the layer of atmosphere that is adjacent to the land and water also gets heated up. This leads to the decrease of air density as the heat causes expansion of gases. With decrease in air density, the air pressure also drops and the air from the cooler layer of atmosphere above comes to fill up the space and this heated air goes up. This causes the convection current to get set up. This causes the global winds and different oceanic currents to flow all over the earth throughout the year.

5 0
3 years ago
Other questions:
  • Which is part of the biosphere? A. humans B. stratosphere C. volcanoes D. oceans
    13·2 answers
  • What is responsible for the decreased stability of rna compared to dna?
    9·1 answer
  • Which would be a result of a malfunctioning excretory system?
    11·2 answers
  • 10 In a solution of 10% sugar and 90% water, I have placed a cell that contains 30% sugar and 70 % water. Which of the following
    7·1 answer
  • Why are the moon’s craters preserved?
    8·1 answer
  • 1.If the same index fossils are found in different rock starta miles apart, what is probably true about the rock layers?
    9·1 answer
  • Black hair is dominant to red hair two black cocker spaniels have 12 puppies 9 black and 3 red what is the genotype of each pare
    6·2 answers
  • The function of red blood cells is _____________
    5·2 answers
  • Is this statement true or false? Voluntary muscles move when you want them to, while involuntary muscles move automatically. I d
    14·1 answer
  • The following DNA nitrogen bases (found in nucleotides) match up to make the rungs of the DNA ladder:
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!