1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kiruha [24]
3 years ago
12

What do the gram stain, acid-fast stain, and endospore stain have in common?

Biology
1 answer:
kirill [66]3 years ago
6 0
Outcome based on cell wall differences.
You might be interested in
Which vitamin is synthesized by microbes in the intestine and helps to maintain bone health
ch4aika [34]
Hi there.

to maintain bone health, fiber is the only vitamin that is synthesized by microbes in the intestine. 

-have a great day :)
4 0
3 years ago
What do you call a group of organisms that are of the same species in an ecosystem?
Phoenix [80]
C Population. A group of Organisms that are of the same species in an ecosystem is a population
6 0
3 years ago
Read 2 more answers
In which zone would you expect to find the greatest abundance of marine organisms? middle intertidal zone supralittoral zone hig
serious [3.7K]

High littoral zone has greatest abundance of marine organisms.

<h3>What is High littoral zone?</h3>

The intertidal zone, also known as the "littoral zone," refers to the seashore that is covered during high tide and exposed during low tide, revealing a unique biome that survives under such fluctuating conditions.

<h3>Where are most marine organisms found?</h3>

The majority of ocean life can be found in coastal habitats on the continental shelf, despite the fact that this area accounts for only 7% of total ocean area. The majority of open ocean habitats are found in the deep ocean beyond the continental shelf. Species that live in the oceans and on the coasts can help to create new habitats.

To learn more about Marine life from the given link

brainly.com/question/2498427

#SPJ4

6 0
1 year ago
What are the parts of an eye
o-na [289]

Answer:

The sclera, or white part of the eye, protects the eyeball.

The pupil, or black dot at the centre of the eye, is an opening through which light can enter the eye.

The iris, or coloured part of the eye, surrounds the pupil.

Explanation:

3 0
3 years ago
Imagine that scientists have discovered an industrial pollutant that modifies the structure of a cell cycle checkpoint protein s
Nadya [2.5K]

Answer:

Carcinogenic

Explanation:

A carcinogenic substance is able to modify or damage the genome in a way which promotes the formation of cancerous cells. Cell cycle checkpoint proteins are very crucial for the progression of normal cell cycle. They check for any anomaly in their designated step and halt the process if it is detected. Repair mechanism is activated and cell cycle does not progress till the damage has been repaired.

Here, the pollutant alters the structure of these proteins such that they lose their function. They are not be able to stop cell cycle from progressing even if there is some damage in the genome. The cell divides and gives rise to more damaged cells. Eventually these cells lose their normal function and just keep dividing due to which their division rate becomes double of the normal rate. It can ultimately give rise to cancer which is why the chemical is carcinogenic.  

7 0
4 years ago
Other questions:
  • How are photosynthesis and cellular respiration linked (molecularly and ecologically)
    12·1 answer
  • A population of rabbits inhabits an island that has an active volcano. The volcano erupted and covered the island destroying mos
    11·2 answers
  • A clear object inside the eye that focuses light on the retina
    13·2 answers
  • In his study of pea plants , Gregor Mendel used which method to produce offspring?
    11·2 answers
  • "The three types of unemployment are A. ​full, frictional, and involuntary unemployment. B. ​natural, unnatural, and cyclical un
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What is the difference between metaphase in mitosis and metaphase I in meiosis? How are they the same?
    11·1 answer
  • ​Which of the following statements is true regarding Cells A and B?
    13·1 answer
  • How does the mitochondria lysosomes and golgi apparatus work together
    8·1 answer
  • 8. When a marine organism settles from the plankton, it.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!