1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Likurg_2 [28]
2 years ago
15

An export processing zone is __________. a. another name for the top five economies in the world b. the line that divides the wo

rld into developed and underdeveloped nations c. a region of a nation that is especially vulnerable to widespread disease d. a region of a nation that gives favorable tax rates to corporations
Biology
2 answers:
kherson [118]2 years ago
8 0

Answer:

D) A region of a nation that gives favorable tax rates to corperations

Explanation:

quester [9]2 years ago
3 0

An export processing zone is a region of a nation that gives favorable tax rates to corporations.

<h3>What do you mean by Export processing zone?</h3>

An export processing zone may be defined as a customs area where one is allowed to import plant, machinery, equipment, and material for the manufacture of export goods under security, without payment of duty.

This export processing zone is responsible for all the activities and duties associated with any goods and services which are exported from other nations.

Therefore, an export processing zone is a region of a nation that gives favorable tax rates to corporations.

To learn more about the Export processing zone, refer to the link;

brainly.com/question/1129074

You might be interested in
______ is a chemical group consisting of one carbon atom, one hydrogen atom, and two oxygen atoms.
Bond [772]

Answer:

like mpopp

Explanation:

4 0
3 years ago
Help please I'm so confused
Sergio [31]

Hi,

Attached is solution diagram. You can see that true breeding means both have same alleles for purple PP and white WW flowers.

They were crossed to produce hybrid plants that all had purple flowers PW because purple was the dominant trait.

However, upon self fertilization of those hybrid plants, both purple and white flower plants were produced in 3:1.

Hope it helps!

5 0
3 years ago
Sharks, whales, and dolphins share similar features such as body shape and the position of fins. However, sharks have gills for
lukranit [14]

Both dolphins and whales still have their hip (pelvic) bones present. These bones connect and transfer the weight of the trunk to the lower limbs.

Thus, <em>the presence of the pelvic bone may indicate that whales had ancestors that walked on land</em>.

6 0
3 years ago
Read 2 more answers
4. For your organ system, describe how the system works at the tissue level. mine is the digestive system
san4es73 [151]
Different systems<span> of the body have different functions. For example, your </span>digestive system<span> is responsible for taking in & processing food, while your </span>respiratory system—working<span> with your</span>circulatory system<span>—is responsible for taking up oxygen and getting rid of carbon dioxide. Hope this helps</span>
5 0
4 years ago
Read 2 more answers
Gardeners often use either chemicals or fences to protect their plants from pests. 60 gardeners were asked about their plant pro
vodomira [7]

There are 16 percent of farmers that are affected by the pest infestation.

What percent of gardeners overall had pests?

We know that three of the 13 farmers who used chemicals had pests whereas Seven of the 47 farmers who used fences had pests. So in total there are 10 farmers that are affected from pest out of 60 farmers.

So we can conclude that There are 16 percent of farmers that are affected by the pest infestation.

Learn more about pest here: brainly.com/question/11050545

#SPJ9

4 0
2 years ago
Other questions:
  • In pigs, the allele for a wavy, rough coat (R) is dominant to the allele for a soft, fine coat (r). A rough coat boar and a soft
    5·2 answers
  • The code name used by journalists Carl Bernstein and Bob Woodward for the high-ranking government official who helped them uncov
    8·1 answer
  • you are studying the relationship between the type of shoe a person where is it how far they can slide down the hallway. The dat
    12·1 answer
  • Describe how the nucleus, endoplasmic reticulum, ribosomes, Golgi apparatus, and vesicles work to produce protein?
    10·1 answer
  • What are the two ways that carbon enters into the atmosphere?
    14·2 answers
  • HELP ASAP
    14·2 answers
  • Part D - Lysogenic Replication in a BacteriophageNow that Lauren knows that she has a lytic bacteriophage, she decides that she
    8·1 answer
  • Venus and Earth both experience a ____ because of heat trapped by their atmospheres.
    13·1 answer
  • BRAINLYEST AND POINTS IF ANSWERED RIGHT
    6·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!