All categories

3 years ago

Which of the following is a primary function of the active site of an enzyme?

1 answer:

3 0

The primary function of the active site of an enzyme is to catalyze the reaction associated with the enzyme (Option c). It is a fundamental structure in the enzyme.

<h3>What is the active site of an enzyme?</h3>

The active site of the enzyme is It is a fundamental structure in the enzyme that has catalytic activity.

The active site of the enzyme is a site that binds to the substrate to form the enzyme-substrate complex.

The formation of this complex leads to the generation of one or more products of a given chemical reaction.

Learn more about enzymes here:

brainly.com/question/1596855

You might be interested in

The brain and spinal cord are parts of which body system?

4vir4ik [10]

Answer:

the central nervous system

Explanation:

The nervous system is made up of the central nervous system and the peripheral nervous system: The brain and the spinal cord are the central nervous system.

3 0

3 years ago

Read 2 more answers

Meselson and Stahl used density labeling of DNA to show that DNA replication occurs via a semiconservative mechanism. In their e

cricket20 [7]

Answer:

The organism previously used 15N for replication so all the DNA molecules were of 15N15N type. Then the organism is shifted to a medium where only 14N is available for replication.
According to semi conservative mode of replication, a newly synthesised DNA molecule consists of one new strand and one parental strand. So after the first round of replication, All the 15N strands will synthesise new DNA strands using 14N resulting into intermediate 15N14N DNA molecules. Hence, only one band would be observed (15N14N) above the original 15N15N band since 15N14N has lighter isotope too so it will be lighter than 15N15N molecules and will lie above it.
After second round of replication, 15N strand from 15N14N would synthesise another 14N strand. 14N strand from 15N14N molecules will also synthesise another 14N strand. So now, 50% of the DNA molecules will be of 15N14N intermediate type and 50% of them will be of 14N14N type.Two bands will be observed above the original 15N15N band. One band of 15N14N molecules will be right above it and other band of 14N14N molecules will be even higher because it is the lightest band since it has only the lighter isotope of nitrogen.

8 0

3 years ago

Name the phase of mitosis

Naya [18.7K]

Answer:

its either telophase or metaphase. i think its closer to telophase though since it has the cleavage furrow.

Explanation:

6 0

3 years ago

What characteristic do all protists have in common?

Ivahew [28]

Answer:

(C)cell nuclei that contain DNA

Explanation:

They are eukaryotic, which means they have a nucleus. Most have mitochondria. They can be parasites. They all prefer aquatic or moist environments.

4 0

3 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago