Answer:
Both contain genetic material, in the form of DNA and/or RNA. Both of them can replicate, that is, produce more organisms similar to themselves. ... They require a host cell to carry out life processes, such as replication and carrying out genetic instructions, etc. Bacteria are relatively bigger in size than viruses.
We are asked to fill up the blank space provided by the question above. The question above state that "<span>At higher doses, __________ causes twitching, irritability, panic, heart attack, and death." The statement talks about a term used when a person suffer such characteristics. The nearest term to described conditions once used by a person is called Cocaine.</span>
<span>The two sentences that accurately describe the girls' experience with heat transfer are "Camille heats a rock in the campfire for 30 minutes, and then removes it with tongs. She greases the rock and lays the bacon strips directly on it." By heating the rocks in the campfire and laying the bacon on the rocks, the girls transferred the heat from the fire to the rocks, and the heat from the rocks to cook the bacon.</span>
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
A. Shellfish will disappear first if an estuary was destroyed.
