1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yanalaym [24]
2 years ago
15

A double-blind, randomized study is being used to test the effectiveness of a new drug that targets the multi-drug resistant bac

terium Clostridium difficile. Infected participants in the study were given either a placebo or the test drug and then monitored for one month for clearance of infection. This type of study can best be characterized as a(n)_________________.
A. observational study
B. cross-sectional study
C. Correlation study
D. experimental study
Biology
1 answer:
fredd [130]2 years ago
8 0

the answer is c. correlation study

You might be interested in
How did Alexander Fleming’s research solve a societal problem?
Dominik [7]
<span>He discovered a new type of medicine that could treat infections.

Hope this helps!

-Payshence xoxo</span>
3 0
3 years ago
Read 2 more answers
What do the spores that plants produce develop into? A. gametophytes. B. fertilization. C. zygotes. or D. sporophytes.
musickatia [10]
Answer:
The life cycle of plants is composed of sporophye generation and gemetophyte generation. They show alternation of generation in which gametophytr produce gametes that develop into sporophytic plant. Sporophye produce spores that develop into gametophyte plants.

Example:
Bryophytes, pinus etc
7 0
2 years ago
Can someone help me please
alexandr402 [8]

D)

Because a scientific theory is something that has been proven over the trials of many tests


Hope that helps :)

5 0
3 years ago
Read 2 more answers
Density-dependent inhibition is a phenomenon in which crowded cells stop dividing at some optimal density and location. This phe
Brilliant_brown [7]

Answer:

This statement is true

Explanation:

Different substances such as growth factors and nutrients affect the mechanism of density-dependent inhibition of growth as cells become more and more numerous

8 0
3 years ago
What steps can someone take to prevent or treat H1N1 influenza?
Leto [7]
Hie there!

➡️If you have swine flu (H1N1 flu), you can give it to others.✔️

➡️Stay home for at least 24 hours after your fever is gone.✔️

➡️Wash your hands thoroughly and frequently. ✔️

➡️Use soap and water, or if they're unavailable, use an alcohol-based hand sanitizer.✔️
5 0
3 years ago
Read 2 more answers
Other questions:
  • The graph shows the change in number of two populations, lions and zebras. The solid line represents the population of zebras an
    12·2 answers
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Which scientist most inspired Darwin to pursue his studies of evolution?
    15·2 answers
  • Through what process do cells become specialized so they can perform specific functions within organisms?
    13·2 answers
  • Receptor molecules on the surface of cells bind specific molecules called, in general, __________
    14·1 answer
  • Which of the following statements is true? The Milky Way Galaxy is the only galaxy in the universe. The earth is always the same
    13·1 answer
  • A client who developed a deep vein thrombosis during a prolonged period of bed rest has deteriorated as the clot has dislodged a
    8·1 answer
  • List 3 characteristics that all prokaryotic cells share.
    15·2 answers
  • Why do gene mutations occur?
    6·1 answer
  • This earth system is concerned with all life on the planet
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!