1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
siniylev [52]
2 years ago
12

Which statements are examples of how the use of resources has changed?

Biology
1 answer:
stiks02 [169]2 years ago
7 0

Answer:

b

Explanation:

You might be interested in
1. What does muscle tissue do?
dezoksy [38]

Answer:

d. movement

Explanation:

take care :)

3 0
3 years ago
List two species that may be threatened by the construction of a solar power tower
DENIUS [597]

Answer: the question is incomplete,below is the complete question.

List two species that may be threatened by the construction of a solar power tower in the California Desert

The answers are, Desert torties, mountain yellow legged frog and Joshua tree.

Construction of a solar power tower in the California Desert will threaten the existence of Desert torties, mountain yellow legged frog and and Joshua tree.

Explanation: The construction of solar power towers in Mojave desert in California poses a threat to the existence of quite a number of plants.The Mojave desert houses the largest solar power plant in the world,creating the solar power tower will create job opportunities for people but at the same time endangering the existence of about 12 rare plants that are found in the region of which Desert torties, mountain yellow legged frog and Joshua tree are greatly included,these plants cannot co-exist with solar thermal mirror arrays,this brings a controversy between energy/electricity generation and wildlife/ecosystem conservation.

3 0
3 years ago
Hormones what they do their target organ what organ produces
kaheart [24]
Hormones are chemical substances that help to regulate processes in the body. Hormones are secreted by glands and travel to their target organs in the bloodstream. Hormones can be used to control human fertility.
7 0
3 years ago
All of the following are stops on the pathway of taste signals except __________.
Troyanec [42]

B. The prefrontal cortex is used to plan complex cognitive behavior, personality expresison, and moderate social behavior.

8 0
3 years ago
Read 2 more answers
You have a cup of vegetable oil and a vial full of normal phospholipids. What would you predict would happen if you dropped the
Jobisdone [24]

The vegetable oil is made up of chains of long fatty acids. These long chains of fatty acids are non-polar in nature, i.e, they do not interact through ionic forces rather by covalent forces. The phospholipids are also long chain fatty acids with an ionic head. The mixing of the vial of phospholipid in vegatable oil will lead to the formation of a micelle where the lipophilic ends of the phospholipid will be on the outside and the lipophobic end will be towards the centre of the micelle.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A thermometer is taken from an inside room to the outside where the air temperature
    7·1 answer
  • Diffusion is movement of a molecule from an area of higher concentration to an area of lower concentration. True or false
    5·1 answer
  • What do all organisms use to pass on information?
    6·1 answer
  • Hemoglobin is
    5·1 answer
  • What human-made structures do you see from 100m?
    8·2 answers
  • Valence is the number of electrons an atom must gain or lose in order to _____ its outer energy level or have a stable octet in
    11·2 answers
  • Which of the following tools helps in the visualization of DNA inside a cell?
    15·1 answer
  • Translate the following AUG CCC AUU AUC CGG
    15·2 answers
  • What is natural resources ??<br><br>with examples ​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!