1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yuri [45]
4 years ago
9

What stood atop a covered chemical waste dump at Love Canal, New York?

Biology
2 answers:
kirill [66]4 years ago
4 0

An elementary school.

Trava [24]4 years ago
3 0

Answer:

An elementary school

You might be interested in
Why would a grassland ecosystem have more primary consumers than a forest ecosystem
Lorico [155]

Answer:

Grass is easier for herbivores to digest.

The energy in trees is less available to herbivores

Explanation:

7 0
3 years ago
Read 2 more answers
When you scratch a mosquito bite, you damage some cells. damaged cells release histamine, which causes localized swelling that c
Marta_Voda [28]
This is an example of positive feedback. Positive feedback is a cyclic process that can continue to amplify your body's response to a stimulus. The scratching worsens the histamine which makes you want to itch even more.

ANSWER: positive feedback

Hope this helps! :)
8 0
3 years ago
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
Why is there so much diversity in life on earth?
Tanya [424]
<span>There is much diversity in life because of evolutionary changes to the DNA</span>
3 0
3 years ago
Where do the spindle fibers attach?
Vesnalui [34]
They attach to chromosome centromeres
6 0
3 years ago
Other questions:
  • Ecosystems that experience the same climate conditions are grouped together into larger reagions is called what?
    11·1 answer
  • What are some negative aspects of plate tectonics
    6·1 answer
  • What is the range for the following set of Measurements 27C, 12C, 31C, 19C, 23C, 11C, 17C
    14·2 answers
  • What would happen if a macromolecule was missing?
    11·2 answers
  • Which statement best describes a herbivore
    7·2 answers
  • Create a Punnett square using the shape of pods trait crossing Heterozygous parents. What percentage of the offspring will be he
    9·1 answer
  • Will Be marked Brainliast!! For an animal to move in one direction, its muscles must do all of the following except
    10·2 answers
  • why is DNA a good molecule (compared to liquid or carbohydrate) to have the instructions for protein synthesis?
    12·1 answer
  • Cells require a thick, jelly-like substance that holds organelles in place inside the cell. This substance is known as -
    5·2 answers
  • Write at least one paragraph for ways that you can observe nutrient cycling in nature there should be multiple ways to describe
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!