1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
HACTEHA [7]
2 years ago
15

How do we know when the moth species Stigmella

Biology
1 answer:
Mademuasel [1]2 years ago
5 0

Yes, the the moth species Stigmella heteromelis is alive due to the presence of desired or favourable environment for their survival.

<h3>Factors affecting the presence of a specie</h3>

The moth species Stigmella will be considered alive if the environment that species of Stigmella needs for their survival is present because if the environment exist on the earth then it is possible that the moth specie Stigmella is present on this planet but if the there is no suitable environment.

Then we make the opinion that the specie of Stigmella heteromelis is not present on this planet so we can conclude that the presence of species on the basis of desired or favourable environment for their survival.

Learn more about fossils here: brainly.com/question/11829803

You might be interested in
What important process happens in the leaves?
djverab [1.8K]
Photosynthesis occurs in the leaves
4 0
4 years ago
Read 2 more answers
How many electrons neutrons protons does CI-
sasho [114]
17 protons 18 neutrons and 18 electrons
4 0
3 years ago
an energy pyramaid illustrates that energy in the form of _______ is lost to the surroundings as it is passed from one organism
finlep [7]

i think it is food because an energy pyramid’s shape shows how the amount energy that enters each level .(chemical energy) witch i  believe is in the form of food ,which decreases as it is used by other animals in the same level.

7 0
3 years ago
What controls population growth?
Archy [21]
One of the things that controls population growth is the availability of food,  the birth rate and death rate, the maximum carrying capacity of an area, and disease.
6 0
3 years ago
Blood typing is an example of ___. this is where there is one gene but that one gene can have several different characteristics
Sauron [17]

Answer:

The correct answer would be multiple alleles.

Multiple allele refers to the condition in which a gene exists in more than two alternative forms in a population that is, it has more than two alleles.

Different allele may provide different traits to the organism.

For example, in humans, blood types or groups are determined by three alleles I^{A}, I^{B} and <em>i.</em>

Three alleles produce four types of blood groups (phenotypes) which are A, B, AB, and O.

8 0
4 years ago
Other questions:
  • The preganglionic cell bodies associated with the highlighted structure are located in the ________ of the spinal cord.
    6·2 answers
  • PLEASE HELP 12. Skates and rays have skeletons made of _____. 13. The series of dramatic changes in body form in an amphibian's
    6·2 answers
  • Why is coral found near the surface of the water?
    8·1 answer
  • Each trait of a plant is determined by
    14·2 answers
  • Two scientists did the same experiment but arrived at different results. The scientists most likely
    11·2 answers
  • Trace the path of lymph from the time it leaves the interstitial spaces to the time that it leaves the lymph nodes.
    15·1 answer
  • A controlled experiment is one that_______________.
    12·1 answer
  • Why/how is biodiversity essential to the health of an ecosystem
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Stages of Germination? it some detail pls?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!