1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tems11 [23]
2 years ago
7

What calculators are allowed on the ap biology exam?.

Biology
1 answer:
3241004551 [841]2 years ago
6 0

Answer:

fourfunction, scientific, or graphing calculator

Explanation:

You might be interested in
The answer is 51.0 ml but can someone explain why please
professor190 [17]

Answer:

\boxed{\sf A. \ 51 \ mL}

Explanation:

Amount of water displaced by the sphere will be equal to the volume of complete sphere.

As the sphere completely sinks to the bottom of the cup.

We have been given;

Diameter of sphere (d) = 4.6 cm

So,

\sf Radius \:  of \:  sphere  \: (r) =  \frac{Diameter \:  of \:  sphere \: (d)}{2}  \\  \sf =  \frac{4.6}{2}  \\ \sf  = 2.3 \: cm

Volume of sphere (V):

\boxed{ \bold{V =  \frac{4}{3} \pi {r}^{3} }}

By substituting value of r we get:

\sf \implies V =  \frac{4}{3}  \times \pi \times  {(2.3)}^{3}  \\  \\  \sf \implies V =  \frac{4}{3}  \times 3.14 \times 12.167 \\  \\ \sf \implies V =    \frac{152.81752}{3} \\  \\   \sf \implies V =  50.94 \:  {cm}^{3}  \\  \\   \sf \implies V  \approx 51 \:  {cm}^{ 3}

1 cm³ = 1 mL

\therefore

V = 51 mL

So,

Water displaced by the sphere = 51 mL

6 0
3 years ago
Which factor would most likely speed up the rate of succession?
Anna35 [415]
<span>Main think, pertaining to the growth of environmental system is based on the type with high rates of copy and growth, they find, are more likely to draw down speeds up the aerobic breakdown of accumulated organic matter the fires. But experiments within the past year show it likely that the particles gain most or all to speed up his rate of spin and equally by extending his arms slow down.</span>
3 0
3 years ago
Define autotrophs, heterotrophs, producers, and photoautotrophs.
sergey [27]
Producers: living things that make their own food through a process called photosynthesis

Autotrophs: an organism that is able to form nutritional organic substances from simple inorganic substances such as carbon dioxide.

Heterotrophs: an organism deriving its nutritional requirements from complex organic substances.

Photo autotrophs: organisms that carry out photosynthesis. Using energy from sunlight, carbon dioxide and water are converted into organic materials to be used in cellular functions such as biosynthesis and respiration.
3 0
3 years ago
What is an individual in an ecosystems?<br> {Give some examples}
Nikolay [14]
Try a bat for a ecosystems
4 0
3 years ago
Fossils help us reconstruct plant and animal life in the past as well as their evolutionary processes, which can be either slow
mezya [45]
The correct answer is

Stasis

Population becomes isolated

After rapid change in isolated population

Reintroduction
6 0
3 years ago
Other questions:
  • What is the nature of "second signal molecules" in signaling pathways?
    8·1 answer
  • The random alignment of maternal and paternal homologous chromosomes during metaphase I is one of the ways genetic variability a
    14·1 answer
  • Many countries use DDT to control the spread of deadly __________.
    11·2 answers
  • Help me please :):
    13·1 answer
  • Kierra weighs 54 kilograms. If she drinks a hydrating sports drink during her workout how many servings must she drink to meet t
    7·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • The Big Bang theory believes that everything in the universe was once concentrated into one point. This point exploded, and ever
    11·1 answer
  • Earth is made up of<br> layers.
    5·1 answer
  • Which one of the following criteria is necessary for natural selection to occur?
    7·1 answer
  • A social consequence describes any change good or bad in the lives of people and how they interact with one another sometimes la
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!