1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Llana [10]
2 years ago
8

Please help me I really need help!!!!

Biology
1 answer:
valentinak56 [21]2 years ago
8 0

Answer:

An inclined plane reduces the effort force by increasing the distance through which the force is applied. So the actual effort decreases and is less than the unity always. Therefore, an inclined plane reduces the effort as well as work done.

Explanation:

You might be interested in
Essay
vesna_86 [32]
Yellowstone
1. Negative environmental impact
2. Positive environmental effects
3. Removal of excess fuel material in forest
4. Preparation of seeds and some plant species for germination
5. Increase turbidity extreme water

Hopefully these are good answers!!
6 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Why ribosomes are called protein factory
Ivenika [448]
More information please
5 0
4 years ago
Name three ways that good health practices can help prevent gastrointestinal disorders?
Ilia_Sergeevich [38]
Answers should include three of the following ideas:
*The body needs exercise to eliminate wastes properly.
*Food poisoning can be prevented by cooking food properly and by sanitizing areas that come into contact with raw food.
*Some forms of functional dypepsia can be prevented by avoiding overeating, avoiding too many fatty foods, and chewing food adequately.
8 0
3 years ago
List six other waste product of certain plants<br>pls help now​
Delicious77 [7]

Answer:

Waste products such as gums, oils, latex, resins, and so on are stored in plant parts such as barks, stems, and leaves. Plants eventually shed these parts. Orange oil, eucalyptus oil, jasmine oil, latex from the rubber tree, papaya tree gums, and acacia gums are all examples of stored waste products.

Explanation:

4 0
3 years ago
Other questions:
  • All of the following factors affect an area s biodiversity EXCEPT
    8·1 answer
  • Interactions between the red blood cell and important molecules, cells, and organs
    6·1 answer
  • A cross-country skier who prefers high elevation but flat terrain is looking for a ski vacation destination.
    14·2 answers
  • Which animals have an amniotic egg
    6·1 answer
  • In watermelons, bitter fruit (B) is dominant over sweet fruit (b), and yellow spots (S) are dominant over no spots (s). The gene
    13·1 answer
  • Which of the following descriptions accurately describes Boyle’s law?View Available Hint(s)Which of the following descriptions a
    13·1 answer
  • Describe how a dihybrid cross can be utilized to track multiple traits in an organism.
    10·1 answer
  • What are the simularitys of owls and chloroplast
    11·1 answer
  • BRAINLYIST PLSSSS HURRY
    5·2 answers
  • What do decomposers leave behind after getting their energy?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!