1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna35 [415]
3 years ago
13

Which movement of substances through a cell membrane against a

Biology
1 answer:
uysha [10]3 years ago
7 0

Active transport

Active transport is the movement of substances through a cell membrane against a  concentration gradient that requires energy.

You might be interested in
Where did all the elements other than hydrogen and helium come from? They were made during the big bang.
AVprozaik [17]
I know this sounds silly but I just took the test they were made in the stars or B
3 0
3 years ago
Read 2 more answers
Cancer cells are rogue cells. List and explain 3 mutations that allow cancer cells to occur:
LuckyWell [14K]
Cancer is unchecked cell growth. Mutations in genes can cause cancer by accelerating cell division rates or inhibiting normal controls on the system, such as cell cycle arrest or programmed cell death. As a mass of cancerous cells grows, it can develop into a tumor
4 0
3 years ago
Which statement about ocean surface currents is false
EastWind [94]

Answer:

B: "They have no effect on air temperature over land on the coast."

Explanation:

Edg 2021

6 0
3 years ago
Read 2 more answers
Ceratium fusus is a protist that is found primarily in coastal waters, especially around the coast of the United Kingdom. These
kotykmax [81]

A chemical defense mechanism is called bioluminescence.

As mentioned in the reaction, Ceratium fusus undergoes a special chemical reaction at night which helps them defend themselves from predators. During this reaction, light is produced inside a living organism. However, this type of reaction does not produce heat although it does produce light.

<h3>What is bioluminescence used for?</h3>

The most well-known purpose of bioluminescence is to defend the organism against attacks by predators. This is because the light confuses or frightens predators.

Besides confusing the predator, the light can also alert large predators to approach the location of the organism, in this way this large predator will eat the predator that is threatening the organism which in our question, is Ceratium fusus.

Many marine organisms use the phenomenon of bioluminescence for their defense, in particular marine invertebrates, vertebrates, certain micro-organisms as well as certain fish and fungi.

Hence concluded that the bioluminescence characteristic of Ceratium fusus is being described.

To know more about bioluminescence  refer to the link :

brainly.com/question/765632

3 0
2 years ago
What would happen to skin cells if mitosis did not ​
olasank [31]

Since mitosis is the division of cells, in this case, skin cells, it allows the dead skin cells to fall off. Also, mitosis can fix any injuries. Without mitosis, these things would not happen.

6 0
3 years ago
Other questions:
  • What are some facts about cats that a very crucial to know?<br> List as many as possible.
    5·2 answers
  • Which of these is a process by which water, carbon dioxide, and energy are formed?
    9·2 answers
  • A scientist performed an experiment to test her hypothesis that a disease in horses was caused by a deficiency in an important m
    8·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The maintenance of a controlled, stable body environment.
    11·1 answer
  • The frequency of sickle-cell anemia, an autosomal recessive condition, is 0.007. Assuming that the population is in H-W equilibr
    13·1 answer
  • What would be the most likely candidate for a complete transmembrane segment of a protein in the lysosomal membrane?
    9·1 answer
  • The diagram below shows a hand warmer. It uses a controlled burn of a type of lighter fluid called naphtha.
    14·1 answer
  • Please help i’ll mark u as the brain thing !!
    11·1 answer
  • Eye color , hair color , and skin color often vary from person to person and even witch in family , one explanation is that
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!