2 years ago

In a criminal court case, who recommends a sentence to the judge?

1 answer:

6 0

Answer:

The people who most commonly speak at a sentencing hearing are the prosecutors, the defense attorney, the victims, and the defendant. Rule 32 of the Federal Rules of Criminal Procedure grants both the defendant and defense counsel the right to speak to the court before a sentence is imposed. First, even before a defendant appears before a judge, prosecutors may agree, as part of a plea agreement, to recommend a lower sentence or to charge a less serious crime in exchange for the defendant's cooperation.

You might be interested in

Under sfac no.6, interrelated elements of financial statements that are directly related to measuring the performance and status

maria [59]

Answer and Explanation:

False

7 0

3 years ago

What is the importance of studying criminology in the social science

oksian1 [2.3K]

Answer: They conduct research, teach and work with different kinds of law enforcement agencies.

They also study the social and psychological factors that cause people to commit crimes and research which approaches to rehabilitation work and maybe do not work.

Explanation:

5 0

3 years ago

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT

andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0

3 years ago

y law, if a food originally contains 50 percent or more of its calories from fat, and the food company reduces the fat by 50 per

atroni [7]

By law, when food originally contains 50 percent or more of its calories from fat, and the food company reduces the fat by 50 percent or more during processing, the food can be labeled as light.

It should be noted that law simply means the principles that are put in place to guide the actions of people.

In this case, when food originally contains 50 percent or more of its calories from fat, and the food company reduces the fat by 50 percent or more during processing, the food can be labeled as light.

Learn more about law on:

brainly.com/question/820417

#SPJ1

6 0

2 years ago

Some still believe that __ simply means admitting children with learning disabilities into mainstream schools, but this is a ver

frez [133]

Answer:

I think the answer to your question is mainstreaming

Explanation:

6 0

3 years ago