1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
2 years ago
10

In a criminal court case, who recommends a sentence to the judge?

Law
1 answer:
Lesechka [4]2 years ago
6 0

Answer:

The people who most commonly speak at a sentencing hearing are the prosecutors, the defense attorney, the victims, and the defendant. Rule 32 of the Federal Rules of Criminal Procedure grants both the defendant and defense counsel the right to speak to the court before a sentence is imposed. First, even before a defendant appears before a judge, prosecutors may agree, as part of a plea agreement, to recommend a lower sentence or to charge a less serious crime in exchange for the defendant's cooperation.

You might be interested in
Under sfac no.6, interrelated elements of financial statements that are directly related to measuring the performance and status
maria [59]

Answer and Explanation:

False

7 0
3 years ago
What is the importance of studying criminology in the social science
oksian1 [2.3K]

Answer: They conduct research, teach and work with different kinds of law enforcement agencies.

  They also study the social  and psychological factors that cause people to commit crimes  and research  which approaches to rehabilitation work and maybe do not work.

Explanation:

5 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
y law, if a food originally contains 50 percent or more of its calories from fat, and the food company reduces the fat by 50 per
atroni [7]

By law, when food originally contains 50 percent or more of its calories from fat, and the food company reduces the fat by 50 percent or more during processing, the food can be labeled as light.

<h3>What is law?</h3>

It should be noted that law simply means the principles that are put in place to guide the actions of people.

In this case, when food originally contains 50 percent or more of its calories from fat, and the food company reduces the fat by 50 percent or more during processing, the food can be labeled as light.

Learn more about law on:

brainly.com/question/820417

#SPJ1

6 0
2 years ago
Some still believe that __ simply means admitting children with learning disabilities into mainstream schools, but this is a ver
frez [133]

Answer:

I think the answer to your question is mainstreaming

Explanation:

6 0
3 years ago
Other questions:
  • 1. Which of the following is an S corporation permitted to do?
    10·1 answer
  • A security services contractor can provide security patrol services to a business on a contractual basis
    13·1 answer
  • Why is the Fifth Amendment important in preserving a citizen’s right to protect oneself?
    9·1 answer
  • if a cop proceeds to pull me over for going over the speed limit and ask “Sir, do you know how fast you were going”, do i then h
    8·1 answer
  • Medical records are protected by the Health Insurance Portability and Accountability Act (HIPAA). Can your medical records be ma
    8·1 answer
  • According to a constitutional court, what is the source of African values?<br><br><br><br><br>​
    5·2 answers
  • Blood stains are found layered on top of each other at a crime scene. This means that more than one person was injured and bleed
    8·2 answers
  • If you have been punished or discriminated against for using your rights, how long do you have to file a complaint with OSHA?
    10·1 answer
  • Which is the biggest difficulty that criminologists face while developing criminological theories
    7·2 answers
  • a man is accused of holding up a liquor store and stealing hundreds of dollars from the cash register. where is this case heard
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!