1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lady bird [3.3K]
4 years ago
7

Three roles and responsibilities the prime minister of Canada has ?anyone ??? Is for right now

Law
1 answer:
Finger [1]4 years ago
8 0
I don’t know I don’t wanna was the day I gotta was a good morning I gotta was a good day I gotta was a good day I
You might be interested in
FELLOW MEP REEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
vfiekz [6]

Answer:

i followed you

Explanation:

Good job!

8 0
3 years ago
Read 2 more answers
The majority of a forensic scientist's time is spent
myrzilka [38]

A forensic scientist's day-to-day activities will vary throughout the week. The majority of their time is spent in the office writing reports and preparing for laboratory visits. Other days, however, they may be carrying out a laboratory visit or attending court as an expert witness (Brightside, 2003).

3 0
3 years ago
List the different courts in your state (Texas is my state)​
Rom4ik [11]

Answer:

mines texas tooo hayyyyyyy!!!!

Explanation:

5 0
3 years ago
Read 2 more answers
Explain the probation and parole functions, and explain the limitations and circumstances of someone on parole.
katrin [286]

Answer:parolee-is someone who's a convicted criminal and allows them to live a new life with supervision to be maintained and make sure they don't do anything their technically still serving time in jail obviously but where they spent jail time they aren't allowed to leave that area for example if they spent it in South Carolina they can't travel to Florida to start a new.

Probation-Is someone who instead of going to jail they will have a officer or court to always report back to with what their doing and where they are they aren't allowed to have any weapons or anything around not even drugs they are allowed to stay in their community only and nowhere else as long as their being supervised

Explanation:they are quite similar with needing to be watched by the police and they are required to check in otherwise it will be trouble for them unless they somehow get their way out of the trouble

8 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • The landmark US Supreme Court case Metro-Goldwin-Mayer Studios Inc. v. Grokster, Ltd., 545 U.S. 913 (2005) exempts information c
    12·2 answers
  • - During the Industrial Revolution in Europe,
    10·1 answer
  • The history of policing in the United States extends back to?
    11·1 answer
  • 13. The middle layer in the American court system is made up of
    7·1 answer
  • Explain the four types of courts and their purpose.
    9·1 answer
  • Rawls might criticize Locke’s social contract on which of the following grounds?
    10·1 answer
  • The reasonable suspicion law derived from The Terry Vs Ohio Supreme Court ruling ?
    11·1 answer
  • Why are some forms of speech not protected by the First Amendment?
    11·1 answer
  • Help me answer thank u I will mark brainliest
    13·2 answers
  • Haji is arrested at a warehouse in Industrial Park and is charged with the crime of theft. Haji will be prosecuted by Group of a
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!