1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svet-max [94.6K]
2 years ago
9

What is a negative aspect of biomass energy?

Biology
2 answers:
Masja [62]2 years ago
8 0

Answer:

A) It releases greenhouse gasses into the atmosphere

Explanation:

satela [25.4K]2 years ago
7 0

1. It releases greenhouse gasses into the atmosphere.

2. It is not a renewable resource.

3. It cannot replenish itself.

4. It is not an abundant resource.

Explanation: It releases greenhouse gasses into the atmosphere.

You might be interested in
Chemicals from sea slugs may be useful in:
user100 [1]
The answer would be sewage treatment plants
7 0
3 years ago
Read 2 more answers
Living things that migrate to survive in the tundra​
Ksivusya [100]

Answer:

Many animals that live in the tundra, like the caribou and the semipalmated plover, migrate to warmer climates during the winter. Others, like the arctic ground squirrel, hibernate during the winter months. There are very few reptiles and amphibians found in the tundra because the temperatures are so cold.

Explanation:

5 0
2 years ago
11. Which of the following is a function of a protein
Anna71 [15]

Answer:

Produces vital body structures, providing energy, providing cell structure, maintaining fluid balance, act as buffers, contributes to immune function.

Explanation:

8 0
3 years ago
Greenhouses are designed to capture the energy of the sun.<br><br><br> True<br><br> False
zysi [14]

i believe the answer is true ^^

5 0
3 years ago
Read 2 more answers
This macromolecule is composed of carbon, hydrogen and oxygen but is not a lipid
ratelena [41]

Answer:

If the macromolecule is not lipid, then IT'S CARBOHYDRATE

5 0
3 years ago
Other questions:
  • 01.03]Which of the following statements about science is true? Science is built on opinions and assumptions. Science is tested b
    12·2 answers
  • Mountain beetles that feed on trees in canadian forests are destroying the forests because the beetle population is:
    11·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What are decomposers?
    9·2 answers
  • Squirrels and chipmunks compete for the same food source. What is most likely to happen to the degree of competition between the
    15·2 answers
  • Multiple questions:
    11·1 answer
  • The lineage that produced chimpanzees and humans split from other
    11·1 answer
  • What is released into the cell during electron transfer?
    7·1 answer
  • PLEASE HELP WILL GIVE BRAINLIEST Explain the process in which root cells get their energy, list all the organelles involved in t
    11·1 answer
  • What is the difference between prokaryotes and eukaryotes? In your answer use the terms nucleus, nucleoid, organelles, size, cyt
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!