Answer:
See the answer below
Explanation:
From the illustration of the experiment, the question that Carson can best answer is that<em> "Do bananas develop more brown spots if they are kept in bags with holes compared to bags without holes?"</em>
The independent variable in the experiment is the hole poked in the bags while the dependent variable is the number of brown spots on each banana. The difference between the subjects is the hole poked in the bags, hence, any difference in the number of brown spots between bananas in the bags with holes and those in the bags without holes can be attributed to the hole poked in the bags.
<u>Therefore, the question that can be answered from the experiment is to see if poking holes in bags make bananas to develop more brown spots compared to bags without holes. </u>
Answer;
A.Vinegar and soda
Explanation;
-A salt is a substance that contains a cation which is a metal ion or an ammonium ion and an anion derived from an acid. It is an ionic compound that can be formed by the neutralization reaction of an acid and a base.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
False
Explanation:
Gram stain technique is a method use to classify bacteria into large groups base on their different cell wall components. It differentiate gram positive and gram negative by coloring them with red or Violet colors.
Gram stain is use for identification and classification of bacteria.
Gram positive stain violet due to presence of thick layers of peptidoglylcan in their cell walls and gram negative stain red due to thin layers of peptidoglylcan in their cell walls.
Atoms are electrically neutral because they have equal numbers of protons positively charged and electrons negatively charged.
